Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626230_s_at:

>probe:Drosophila_2:1626230_s_at:108:307; Interrogation_Position=105; Antisense; CCTGATCGGCTTCTGGATTTGGTTA
>probe:Drosophila_2:1626230_s_at:255:21; Interrogation_Position=121; Antisense; ATTTGGTTAATATCGCGTAGCTGCC
>probe:Drosophila_2:1626230_s_at:614:675; Interrogation_Position=138; Antisense; TAGCTGCCTCTTTTCGCAAAGCGAG
>probe:Drosophila_2:1626230_s_at:65:255; Interrogation_Position=154; Antisense; CAAAGCGAGCCGGTTGCGTTTAAGA
>probe:Drosophila_2:1626230_s_at:493:487; Interrogation_Position=187; Antisense; GTACGTCGCTTTCCAGGAGGTTCAA
>probe:Drosophila_2:1626230_s_at:289:373; Interrogation_Position=279; Antisense; GAAGTACACCGGTTCCAATCAAGGT
>probe:Drosophila_2:1626230_s_at:407:9; Interrogation_Position=304; Antisense; ATTCCTAAGGCGAACTTCTGTCATT
>probe:Drosophila_2:1626230_s_at:55:171; Interrogation_Position=345; Antisense; AAAGTCGGCTGTTTCCATATCTCCA
>probe:Drosophila_2:1626230_s_at:62:173; Interrogation_Position=398; Antisense; AAAGAGCCACCGAATCTGTACCAAA
>probe:Drosophila_2:1626230_s_at:64:199; Interrogation_Position=438; Antisense; AACGATTCTATCTACCAGTCAGGCT
>probe:Drosophila_2:1626230_s_at:654:445; Interrogation_Position=470; Antisense; GATCACCCTTCTGTAGTCCAAAAAG
>probe:Drosophila_2:1626230_s_at:417:435; Interrogation_Position=58; Antisense; GAGGTTAGTCCGATGATCCTGTGCC
>probe:Drosophila_2:1626230_s_at:126:59; Interrogation_Position=70; Antisense; ATGATCCTGTGCCTTATGCTGACCT
>probe:Drosophila_2:1626230_s_at:623:51; Interrogation_Position=85; Antisense; ATGCTGACCTTGTTGCTTTTCCTGA

Paste this into a BLAST search page for me
CCTGATCGGCTTCTGGATTTGGTTAATTTGGTTAATATCGCGTAGCTGCCTAGCTGCCTCTTTTCGCAAAGCGAGCAAAGCGAGCCGGTTGCGTTTAAGAGTACGTCGCTTTCCAGGAGGTTCAAGAAGTACACCGGTTCCAATCAAGGTATTCCTAAGGCGAACTTCTGTCATTAAAGTCGGCTGTTTCCATATCTCCAAAAGAGCCACCGAATCTGTACCAAAAACGATTCTATCTACCAGTCAGGCTGATCACCCTTCTGTAGTCCAAAAAGGAGGTTAGTCCGATGATCCTGTGCCATGATCCTGTGCCTTATGCTGACCTATGCTGACCTTGTTGCTTTTCCTGA

Full Affymetrix probeset data:

Annotations for 1626230_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime