FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626231_at:

>probe:Drosophila_2:1626231_at:598:231; Interrogation_Position=1020; Antisense; AATGCTGTCGGCCTGGAATCTGAGA
>probe:Drosophila_2:1626231_at:328:423; Interrogation_Position=1043; Antisense; GAGAACCTCATCCTAGATACTTGCC
>probe:Drosophila_2:1626231_at:37:413; Interrogation_Position=489; Antisense; GACCCTGAGCATTGACGAATTCCTG
>probe:Drosophila_2:1626231_at:259:363; Interrogation_Position=505; Antisense; GAATTCCTGAAGTTTCTACACGCCC
>probe:Drosophila_2:1626231_at:501:157; Interrogation_Position=522; Antisense; ACACGCCCTGCACATTGAAATACAT
>probe:Drosophila_2:1626231_at:527:371; Interrogation_Position=570; Antisense; GAAGGAGTCCAGTTCGGTGATCTCT
>probe:Drosophila_2:1626231_at:337:513; Interrogation_Position=586; Antisense; GTGATCTCTGAATTGGACTTCGCCA
>probe:Drosophila_2:1626231_at:267:499; Interrogation_Position=647; Antisense; GTCGTGAAATCCTCAAGCGGGTCAA
>probe:Drosophila_2:1626231_at:506:667; Interrogation_Position=702; Antisense; TACTCTGGAGGAGTTCTTGGCCTTC
>probe:Drosophila_2:1626231_at:91:545; Interrogation_Position=756; Antisense; GGATAACGCCCTAGCATTTTACTAT
>probe:Drosophila_2:1626231_at:544:457; Interrogation_Position=793; Antisense; GATATCTCACCCAAAACTATGCGGC
>probe:Drosophila_2:1626231_at:212:273; Interrogation_Position=819; Antisense; CATTGCGTATGTAGTGACCGGCGTA
>probe:Drosophila_2:1626231_at:29:515; Interrogation_Position=868; Antisense; GTGATTTTCTGCATCTTCGATCGGA
>probe:Drosophila_2:1626231_at:306:445; Interrogation_Position=945; Antisense; GATGCATCCCATACCGTTGCGAAAA

Paste this into a BLAST search page for me
AATGCTGTCGGCCTGGAATCTGAGAGAGAACCTCATCCTAGATACTTGCCGACCCTGAGCATTGACGAATTCCTGGAATTCCTGAAGTTTCTACACGCCCACACGCCCTGCACATTGAAATACATGAAGGAGTCCAGTTCGGTGATCTCTGTGATCTCTGAATTGGACTTCGCCAGTCGTGAAATCCTCAAGCGGGTCAATACTCTGGAGGAGTTCTTGGCCTTCGGATAACGCCCTAGCATTTTACTATGATATCTCACCCAAAACTATGCGGCCATTGCGTATGTAGTGACCGGCGTAGTGATTTTCTGCATCTTCGATCGGAGATGCATCCCATACCGTTGCGAAAA

Full Affymetrix probeset data:

Annotations for 1626231_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720