FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626232_at:

>probe:Drosophila_2:1626232_at:444:191; Interrogation_Position=4402; Antisense; AACTTGCAGTTTCAAGGGCAGCAGG
>probe:Drosophila_2:1626232_at:652:349; Interrogation_Position=4419; Antisense; GCAGCAGGAAATGTTGGTCTACCAC
>probe:Drosophila_2:1626232_at:494:151; Interrogation_Position=4451; Antisense; ACATTTCTGCGCCAAGCAGTGGCAA
>probe:Drosophila_2:1626232_at:340:349; Interrogation_Position=4466; Antisense; GCAGTGGCAATACCAATGCGAGCAA
>probe:Drosophila_2:1626232_at:396:161; Interrogation_Position=4512; Antisense; ACAATCCAATCAGTGAGGGTCAACT
>probe:Drosophila_2:1626232_at:34:253; Interrogation_Position=4559; Antisense; CAAGCTGCACGGTTCCATAAGAATT
>probe:Drosophila_2:1626232_at:138:363; Interrogation_Position=4587; Antisense; GAATAGCTTTAACAACCGAGTGAAA
>probe:Drosophila_2:1626232_at:15:149; Interrogation_Position=4611; Antisense; ACTTTCTACTTTCGTATTTGCTCCG
>probe:Drosophila_2:1626232_at:203:389; Interrogation_Position=4641; Antisense; GAAAAACAATCCCAAGCACCTCTGT
>probe:Drosophila_2:1626232_at:72:355; Interrogation_Position=4656; Antisense; GCACCTCTGTAGTGAAACTTTGTTT
>probe:Drosophila_2:1626232_at:30:257; Interrogation_Position=4681; Antisense; CAAACTCTCTTTTACACTGACAACA
>probe:Drosophila_2:1626232_at:77:89; Interrogation_Position=4719; Antisense; AGTAGCAAATACCTGCACTTTAATT
>probe:Drosophila_2:1626232_at:12:195; Interrogation_Position=4839; Antisense; AACTGAAGATCGGACTCCAGGGAGA
>probe:Drosophila_2:1626232_at:439:197; Interrogation_Position=4871; Antisense; AACGCAATTTTTCCATTTGTCAACT

Paste this into a BLAST search page for me
AACTTGCAGTTTCAAGGGCAGCAGGGCAGCAGGAAATGTTGGTCTACCACACATTTCTGCGCCAAGCAGTGGCAAGCAGTGGCAATACCAATGCGAGCAAACAATCCAATCAGTGAGGGTCAACTCAAGCTGCACGGTTCCATAAGAATTGAATAGCTTTAACAACCGAGTGAAAACTTTCTACTTTCGTATTTGCTCCGGAAAAACAATCCCAAGCACCTCTGTGCACCTCTGTAGTGAAACTTTGTTTCAAACTCTCTTTTACACTGACAACAAGTAGCAAATACCTGCACTTTAATTAACTGAAGATCGGACTCCAGGGAGAAACGCAATTTTTCCATTTGTCAACT

Full Affymetrix probeset data:

Annotations for 1626232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720