FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626233_at:

>probe:Drosophila_2:1626233_at:332:253; Interrogation_Position=1619; Antisense; CAAGAAGCTGCTTGACATCCACATG
>probe:Drosophila_2:1626233_at:61:689; Interrogation_Position=1653; Antisense; TTTGCGTCCGGAGGAGTCTACGGCA
>probe:Drosophila_2:1626233_at:375:141; Interrogation_Position=1672; Antisense; ACGGCAGACTTATGCCTGTGGCGGA
>probe:Drosophila_2:1626233_at:2:141; Interrogation_Position=1698; Antisense; ACGGAGACCCAGGACATGAACGGCA
>probe:Drosophila_2:1626233_at:657:27; Interrogation_Position=1723; Antisense; ATACCAGTACCAAACTCACGGCGGA
>probe:Drosophila_2:1626233_at:469:527; Interrogation_Position=1778; Antisense; GGGACACTTTGTCTACCTGTAGCGA
>probe:Drosophila_2:1626233_at:257:485; Interrogation_Position=1839; Antisense; GTATGCCACTAGGATCGTCTGATGA
>probe:Drosophila_2:1626233_at:355:445; Interrogation_Position=1907; Antisense; GATGCATTTGTAGTTTAAGCCGTTA
>probe:Drosophila_2:1626233_at:37:25; Interrogation_Position=1954; Antisense; ATATGCCTGCGAGTAATGTATCCTA
>probe:Drosophila_2:1626233_at:204:457; Interrogation_Position=2021; Antisense; GATACTTTGTCCCTAGTGTAATGCA
>probe:Drosophila_2:1626233_at:105:393; Interrogation_Position=2048; Antisense; GAAACCATCTGCTAACAATCCCAAA
>probe:Drosophila_2:1626233_at:534:25; Interrogation_Position=2085; Antisense; ATAGCTTAACGCTTTAGTCCCGCAA
>probe:Drosophila_2:1626233_at:208:503; Interrogation_Position=2101; Antisense; GTCCCGCAACTAAAGCTTCGATAAG
>probe:Drosophila_2:1626233_at:564:675; Interrogation_Position=2140; Antisense; TAGCTTGTGGCTAACATTCGTGTAA

Paste this into a BLAST search page for me
CAAGAAGCTGCTTGACATCCACATGTTTGCGTCCGGAGGAGTCTACGGCAACGGCAGACTTATGCCTGTGGCGGAACGGAGACCCAGGACATGAACGGCAATACCAGTACCAAACTCACGGCGGAGGGACACTTTGTCTACCTGTAGCGAGTATGCCACTAGGATCGTCTGATGAGATGCATTTGTAGTTTAAGCCGTTAATATGCCTGCGAGTAATGTATCCTAGATACTTTGTCCCTAGTGTAATGCAGAAACCATCTGCTAACAATCCCAAAATAGCTTAACGCTTTAGTCCCGCAAGTCCCGCAACTAAAGCTTCGATAAGTAGCTTGTGGCTAACATTCGTGTAA

Full Affymetrix probeset data:

Annotations for 1626233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720