FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626235_at:

>probe:Drosophila_2:1626235_at:84:687; Interrogation_Position=2844; Antisense; TTTTTTGGATGCATTTAGTCGTTAA
>probe:Drosophila_2:1626235_at:103:55; Interrogation_Position=2949; Antisense; ATGAAGACTCCGGAAAGGTGCTCCA
>probe:Drosophila_2:1626235_at:596:623; Interrogation_Position=2957; Antisense; TCCGGAAAGGTGCTCCAGGCTTAAG
>probe:Drosophila_2:1626235_at:413:75; Interrogation_Position=2980; Antisense; AGGAGACGGATGTTATGCAACGCAT
>probe:Drosophila_2:1626235_at:647:359; Interrogation_Position=2996; Antisense; GCAACGCATCCACTAGGCATAAGGG
>probe:Drosophila_2:1626235_at:619:115; Interrogation_Position=3078; Antisense; AGCTTGTAAGTTTGTGTGGTATGGA
>probe:Drosophila_2:1626235_at:681:15; Interrogation_Position=3116; Antisense; ATTTTGCTTTCGGACATTTGTTTTG
>probe:Drosophila_2:1626235_at:295:693; Interrogation_Position=3145; Antisense; TTTTTTGTGTGCTCTTTTCGACCGG
>probe:Drosophila_2:1626235_at:196:693; Interrogation_Position=3160; Antisense; TTTCGACCGGCATCCAAAACATAAT
>probe:Drosophila_2:1626235_at:437:701; Interrogation_Position=3204; Antisense; TTTTAGTACATTCTCACTCTCACAC
>probe:Drosophila_2:1626235_at:579:155; Interrogation_Position=3254; Antisense; ACAGACTTACTGACGCACACATACA
>probe:Drosophila_2:1626235_at:232:355; Interrogation_Position=3268; Antisense; GCACACATACAAAACCGACTACCAT
>probe:Drosophila_2:1626235_at:84:157; Interrogation_Position=3279; Antisense; AAACCGACTACCATTTTCCATTGAT
>probe:Drosophila_2:1626235_at:686:359; Interrogation_Position=3323; Antisense; GCAACTCCTTGCATGCATATTAAAA

Paste this into a BLAST search page for me
TTTTTTGGATGCATTTAGTCGTTAAATGAAGACTCCGGAAAGGTGCTCCATCCGGAAAGGTGCTCCAGGCTTAAGAGGAGACGGATGTTATGCAACGCATGCAACGCATCCACTAGGCATAAGGGAGCTTGTAAGTTTGTGTGGTATGGAATTTTGCTTTCGGACATTTGTTTTGTTTTTTGTGTGCTCTTTTCGACCGGTTTCGACCGGCATCCAAAACATAATTTTTAGTACATTCTCACTCTCACACACAGACTTACTGACGCACACATACAGCACACATACAAAACCGACTACCATAAACCGACTACCATTTTCCATTGATGCAACTCCTTGCATGCATATTAAAA

Full Affymetrix probeset data:

Annotations for 1626235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720