FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626236_at:

>probe:Drosophila_2:1626236_at:717:439; Interrogation_Position=273; Antisense; GAGGCGCCAGCGATCAACATGAACG
>probe:Drosophila_2:1626236_at:205:565; Interrogation_Position=310; Antisense; GGAATCTACTGCCAGCTGTCAAGGA
>probe:Drosophila_2:1626236_at:218:373; Interrogation_Position=333; Antisense; GAAGGGATCCAAACGGCTCTGAGTA
>probe:Drosophila_2:1626236_at:106:229; Interrogation_Position=370; Antisense; AATGGCTGGGCTGTGGCATGACCTA
>probe:Drosophila_2:1626236_at:347:277; Interrogation_Position=392; Antisense; CTATACCCTGTTCGAATGCCTTAAG
>probe:Drosophila_2:1626236_at:509:557; Interrogation_Position=416; Antisense; GGACAACCTGGAGCAATTGACCGCA
>probe:Drosophila_2:1626236_at:525:3; Interrogation_Position=431; Antisense; ATTGACCGCAGAGCAACCCGAATCT
>probe:Drosophila_2:1626236_at:692:363; Interrogation_Position=450; Antisense; GAATCTGCACCCACGGTGGCGTTAG
>probe:Drosophila_2:1626236_at:419:583; Interrogation_Position=482; Antisense; TGGCGTGGGTGCTCTAAAGATCTCC
>probe:Drosophila_2:1626236_at:495:171; Interrogation_Position=497; Antisense; AAAGATCTCCGATCCCAATGCCGAT
>probe:Drosophila_2:1626236_at:697:369; Interrogation_Position=548; Antisense; GAAGGAGCACCTGACTAAGGCGCAA
>probe:Drosophila_2:1626236_at:39:467; Interrogation_Position=627; Antisense; GATTGGGTGGACCTCGTCAAGCATT
>probe:Drosophila_2:1626236_at:485:181; Interrogation_Position=669; Antisense; AAAAACGATGATTCTCTCACTGCCG
>probe:Drosophila_2:1626236_at:424:431; Interrogation_Position=837; Antisense; GAGTAACTGCATGGGCGGCTATCAT

Paste this into a BLAST search page for me
GAGGCGCCAGCGATCAACATGAACGGGAATCTACTGCCAGCTGTCAAGGAGAAGGGATCCAAACGGCTCTGAGTAAATGGCTGGGCTGTGGCATGACCTACTATACCCTGTTCGAATGCCTTAAGGGACAACCTGGAGCAATTGACCGCAATTGACCGCAGAGCAACCCGAATCTGAATCTGCACCCACGGTGGCGTTAGTGGCGTGGGTGCTCTAAAGATCTCCAAAGATCTCCGATCCCAATGCCGATGAAGGAGCACCTGACTAAGGCGCAAGATTGGGTGGACCTCGTCAAGCATTAAAAACGATGATTCTCTCACTGCCGGAGTAACTGCATGGGCGGCTATCAT

Full Affymetrix probeset data:

Annotations for 1626236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720