FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626238_at:

>probe:Drosophila_2:1626238_at:410:465; Interrogation_Position=3130; Antisense; GATTGGCCATGCAATTGCAGCCGGA
>probe:Drosophila_2:1626238_at:3:331; Interrogation_Position=3213; Antisense; GCGGAGGCAGAGTCTTGGTTCAAAA
>probe:Drosophila_2:1626238_at:118:591; Interrogation_Position=3228; Antisense; TGGTTCAAAAGAGCCCTCCAGTTGG
>probe:Drosophila_2:1626238_at:148:587; Interrogation_Position=3259; Antisense; TGGAGCCCAGTTCGCATCATCATTA
>probe:Drosophila_2:1626238_at:261:647; Interrogation_Position=3275; Antisense; TCATCATTATGCTGACTTCCTGGAG
>probe:Drosophila_2:1626238_at:370:553; Interrogation_Position=3296; Antisense; GGAGCAGCAGGAGCGTCATCATGAA
>probe:Drosophila_2:1626238_at:472:35; Interrogation_Position=3313; Antisense; ATCATGAAGCTCTCGGTCTTCGCTT
>probe:Drosophila_2:1626238_at:545:215; Interrogation_Position=3361; Antisense; AAGATTACACCCTGCAATCCTGCGT
>probe:Drosophila_2:1626238_at:605:355; Interrogation_Position=3393; Antisense; GCACTGCGTCTGTTGAATCGTCTGG
>probe:Drosophila_2:1626238_at:12:237; Interrogation_Position=3408; Antisense; AATCGTCTGGCCGAAGCGGAGCTGT
>probe:Drosophila_2:1626238_at:516:393; Interrogation_Position=3439; Antisense; GAAAGGCGGTCACCTTGCAACCGAT
>probe:Drosophila_2:1626238_at:68:323; Interrogation_Position=3490; Antisense; GCGCCATTCTGCAGATGCGTGGTCT
>probe:Drosophila_2:1626238_at:708:685; Interrogation_Position=3537; Antisense; TATCACAAGGCCTTGGAGCTCCAGC
>probe:Drosophila_2:1626238_at:37:75; Interrogation_Position=3563; Antisense; AGGACATGCCATCAGCCGAGCAAAT

Paste this into a BLAST search page for me
GATTGGCCATGCAATTGCAGCCGGAGCGGAGGCAGAGTCTTGGTTCAAAATGGTTCAAAAGAGCCCTCCAGTTGGTGGAGCCCAGTTCGCATCATCATTATCATCATTATGCTGACTTCCTGGAGGGAGCAGCAGGAGCGTCATCATGAAATCATGAAGCTCTCGGTCTTCGCTTAAGATTACACCCTGCAATCCTGCGTGCACTGCGTCTGTTGAATCGTCTGGAATCGTCTGGCCGAAGCGGAGCTGTGAAAGGCGGTCACCTTGCAACCGATGCGCCATTCTGCAGATGCGTGGTCTTATCACAAGGCCTTGGAGCTCCAGCAGGACATGCCATCAGCCGAGCAAAT

Full Affymetrix probeset data:

Annotations for 1626238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720