Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626239_at:

>probe:Drosophila_2:1626239_at:272:291; Interrogation_Position=5204; Antisense; CGGGACACGACTTCTGCAAGCATAA
>probe:Drosophila_2:1626239_at:201:17; Interrogation_Position=5242; Antisense; ATTTCCGACACAGAATCAGCTTTTC
>probe:Drosophila_2:1626239_at:127:485; Interrogation_Position=5291; Antisense; GTATGTATATCTTTAGCCGACCGTG
>probe:Drosophila_2:1626239_at:258:673; Interrogation_Position=5304; Antisense; TAGCCGACCGTGTATGTAGTTTTTT
>probe:Drosophila_2:1626239_at:79:487; Interrogation_Position=5319; Antisense; GTAGTTTTTTATAATGCCGGATCGA
>probe:Drosophila_2:1626239_at:646:109; Interrogation_Position=5447; Antisense; AGAATATATTGCAACCAGGCGGTAA
>probe:Drosophila_2:1626239_at:678:59; Interrogation_Position=5463; Antisense; AGGCGGTAAAACGTCTGCTACTCCT
>probe:Drosophila_2:1626239_at:499:619; Interrogation_Position=5478; Antisense; TGCTACTCCTAATGACGCCACAATA
>probe:Drosophila_2:1626239_at:182:273; Interrogation_Position=5550; Antisense; CATAAATGTTTGTACGACGTGCTCG
>probe:Drosophila_2:1626239_at:564:135; Interrogation_Position=5563; Antisense; ACGACGTGCTCGATTAGCGGACGTT
>probe:Drosophila_2:1626239_at:656:329; Interrogation_Position=5579; Antisense; GCGGACGTTGATGTGTGCTAGCTAT
>probe:Drosophila_2:1626239_at:637:515; Interrogation_Position=5591; Antisense; GTGTGCTAGCTATCCTATTGCAAAA
>probe:Drosophila_2:1626239_at:411:525; Interrogation_Position=5643; Antisense; GGGCATCTGCTAATGTTTGTATGAT
>probe:Drosophila_2:1626239_at:605:369; Interrogation_Position=5745; Antisense; GAATGTACTACTTACTATCGAGTGG

Paste this into a BLAST search page for me
CGGGACACGACTTCTGCAAGCATAAATTTCCGACACAGAATCAGCTTTTCGTATGTATATCTTTAGCCGACCGTGTAGCCGACCGTGTATGTAGTTTTTTGTAGTTTTTTATAATGCCGGATCGAAGAATATATTGCAACCAGGCGGTAAAGGCGGTAAAACGTCTGCTACTCCTTGCTACTCCTAATGACGCCACAATACATAAATGTTTGTACGACGTGCTCGACGACGTGCTCGATTAGCGGACGTTGCGGACGTTGATGTGTGCTAGCTATGTGTGCTAGCTATCCTATTGCAAAAGGGCATCTGCTAATGTTTGTATGATGAATGTACTACTTACTATCGAGTGG

Full Affymetrix probeset data:

Annotations for 1626239_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime