FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626241_at:

>probe:Drosophila_2:1626241_at:510:325; Interrogation_Position=352; Antisense; GCGAGAAGAACTGTCCGTCGGGCTT
>probe:Drosophila_2:1626241_at:563:631; Interrogation_Position=369; Antisense; TCGGGCTTCCAAGATGGGTTCTGGT
>probe:Drosophila_2:1626241_at:325:729; Interrogation_Position=419; Antisense; TTGTGCAGAAGTGCGCCCAGTGCCA
>probe:Drosophila_2:1626241_at:138:323; Interrogation_Position=461; Antisense; GCAAACACAAGGTGGGCCCAAATCT
>probe:Drosophila_2:1626241_at:444:221; Interrogation_Position=505; Antisense; AAGTGTGGCACAGCAGCGGGATACA
>probe:Drosophila_2:1626241_at:518:529; Interrogation_Position=522; Antisense; GGGATACAAGTATACCGATGCCAAT
>probe:Drosophila_2:1626241_at:277:409; Interrogation_Position=583; Antisense; GACGAGTACCTCAAGGACCCGAAGA
>probe:Drosophila_2:1626241_at:319:439; Interrogation_Position=627; Antisense; GATGGTGTTCGCAGGTCTTAAAAAG
>probe:Drosophila_2:1626241_at:500:73; Interrogation_Position=656; Antisense; AGGAGCGGGCCGATTTGATTGCCTT
>probe:Drosophila_2:1626241_at:92:465; Interrogation_Position=672; Antisense; GATTGCCTTCCTCAAGTCAAACAAG
>probe:Drosophila_2:1626241_at:562:491; Interrogation_Position=687; Antisense; GTCAAACAAGTAGAATCGCCTGCGA
>probe:Drosophila_2:1626241_at:386:389; Interrogation_Position=710; Antisense; GAAACAACAAGATCGGCCACCATGC
>probe:Drosophila_2:1626241_at:61:579; Interrogation_Position=724; Antisense; GGCCACCATGCTATCCAGAAAACTG
>probe:Drosophila_2:1626241_at:449:429; Interrogation_Position=777; Antisense; GATGACGTATTTCACTTGGATTTCG

Paste this into a BLAST search page for me
GCGAGAAGAACTGTCCGTCGGGCTTTCGGGCTTCCAAGATGGGTTCTGGTTTGTGCAGAAGTGCGCCCAGTGCCAGCAAACACAAGGTGGGCCCAAATCTAAGTGTGGCACAGCAGCGGGATACAGGGATACAAGTATACCGATGCCAATGACGAGTACCTCAAGGACCCGAAGAGATGGTGTTCGCAGGTCTTAAAAAGAGGAGCGGGCCGATTTGATTGCCTTGATTGCCTTCCTCAAGTCAAACAAGGTCAAACAAGTAGAATCGCCTGCGAGAAACAACAAGATCGGCCACCATGCGGCCACCATGCTATCCAGAAAACTGGATGACGTATTTCACTTGGATTTCG

Full Affymetrix probeset data:

Annotations for 1626241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720