FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626242_at:

>probe:Drosophila_2:1626242_at:312:621; Interrogation_Position=113; Antisense; TGCTGTACAAGCTGAATCCTGAAGA
>probe:Drosophila_2:1626242_at:85:219; Interrogation_Position=139; Antisense; AAGTACGAGGCAGACCTGGTGCCCG
>probe:Drosophila_2:1626242_at:559:727; Interrogation_Position=14; Antisense; TTGTGTGTGGCTTTTGGACCATCAT
>probe:Drosophila_2:1626242_at:215:291; Interrogation_Position=174; Antisense; CGTGATTCCGCTGACAGTGCTGGAG
>probe:Drosophila_2:1626242_at:64:327; Interrogation_Position=227; Antisense; GCGAGGAGTACAAAGCGGCCTACCT
>probe:Drosophila_2:1626242_at:82:343; Interrogation_Position=23; Antisense; GCTTTTGGACCATCATCATCACTAT
>probe:Drosophila_2:1626242_at:272:361; Interrogation_Position=254; Antisense; GCAAGCTGCGTAAACAGGTGCTCCA
>probe:Drosophila_2:1626242_at:28:189; Interrogation_Position=266; Antisense; AACAGGTGCTCCAGCGAACAGAGAA
>probe:Drosophila_2:1626242_at:201:399; Interrogation_Position=310; Antisense; GACAGCGAGGATGTCCTGATCACAG
>probe:Drosophila_2:1626242_at:122:605; Interrogation_Position=326; Antisense; TGATCACAGTGAAGACGCAGAAACT
>probe:Drosophila_2:1626242_at:335:37; Interrogation_Position=37; Antisense; ATCATCACTATGACCGATCTTCTGC
>probe:Drosophila_2:1626242_at:162:291; Interrogation_Position=372; Antisense; CGTCCCAGCCACACAGGCGGATTGA
>probe:Drosophila_2:1626242_at:116:683; Interrogation_Position=45; Antisense; TATGACCGATCTTCTGCCGCGATTG
>probe:Drosophila_2:1626242_at:29:627; Interrogation_Position=59; Antisense; TGCCGCGATTGCTGGTTCTGGTGCT

Paste this into a BLAST search page for me
TGCTGTACAAGCTGAATCCTGAAGAAAGTACGAGGCAGACCTGGTGCCCGTTGTGTGTGGCTTTTGGACCATCATCGTGATTCCGCTGACAGTGCTGGAGGCGAGGAGTACAAAGCGGCCTACCTGCTTTTGGACCATCATCATCACTATGCAAGCTGCGTAAACAGGTGCTCCAAACAGGTGCTCCAGCGAACAGAGAAGACAGCGAGGATGTCCTGATCACAGTGATCACAGTGAAGACGCAGAAACTATCATCACTATGACCGATCTTCTGCCGTCCCAGCCACACAGGCGGATTGATATGACCGATCTTCTGCCGCGATTGTGCCGCGATTGCTGGTTCTGGTGCT

Full Affymetrix probeset data:

Annotations for 1626242_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720