FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626243_at:

>probe:Drosophila_2:1626243_at:327:441; Interrogation_Position=246; Antisense; GATGACTCAACTGTATCCGGATTTA
>probe:Drosophila_2:1626243_at:276:709; Interrogation_Position=268; Antisense; TTAATAGCTGCCAGTTGGGCCTCCA
>probe:Drosophila_2:1626243_at:459:371; Interrogation_Position=326; Antisense; GAAGGCGCTCCAGTGATTGCCAGGA
>probe:Drosophila_2:1626243_at:215:691; Interrogation_Position=352; Antisense; TTTGGCTACTCATCCATGCTAGAAC
>probe:Drosophila_2:1626243_at:200:49; Interrogation_Position=367; Antisense; ATGCTAGAACTTTTCACCGAGGATT
>probe:Drosophila_2:1626243_at:13:391; Interrogation_Position=406; Antisense; GAAACTCGTGCCTGGTTTTATCAAA
>probe:Drosophila_2:1626243_at:108:387; Interrogation_Position=520; Antisense; GAACAACTTTGCCAGGATGCGTTTG
>probe:Drosophila_2:1626243_at:393:729; Interrogation_Position=568; Antisense; TTGGCCCATGGCGTTGAGCAGACGA
>probe:Drosophila_2:1626243_at:185:355; Interrogation_Position=596; Antisense; GCAAATTCGGCGGATTCGGGTTCAA
>probe:Drosophila_2:1626243_at:207:291; Interrogation_Position=612; Antisense; CGGGTTCAATCAGAGCGAGCGTTAT
>probe:Drosophila_2:1626243_at:357:339; Interrogation_Position=637; Antisense; GCTCAGGTAATCTTCACGCATGGCG
>probe:Drosophila_2:1626243_at:365:1; Interrogation_Position=704; Antisense; AGGCTATAGTCCTGACGGGCTACTC
>probe:Drosophila_2:1626243_at:468:347; Interrogation_Position=729; Antisense; GCACGTCGAGGATTTGTCCAGCATC
>probe:Drosophila_2:1626243_at:472:207; Interrogation_Position=787; Antisense; AAGCTGCGTGTTATGTCCTTTCTGC

Paste this into a BLAST search page for me
GATGACTCAACTGTATCCGGATTTATTAATAGCTGCCAGTTGGGCCTCCAGAAGGCGCTCCAGTGATTGCCAGGATTTGGCTACTCATCCATGCTAGAACATGCTAGAACTTTTCACCGAGGATTGAAACTCGTGCCTGGTTTTATCAAAGAACAACTTTGCCAGGATGCGTTTGTTGGCCCATGGCGTTGAGCAGACGAGCAAATTCGGCGGATTCGGGTTCAACGGGTTCAATCAGAGCGAGCGTTATGCTCAGGTAATCTTCACGCATGGCGAGGCTATAGTCCTGACGGGCTACTCGCACGTCGAGGATTTGTCCAGCATCAAGCTGCGTGTTATGTCCTTTCTGC

Full Affymetrix probeset data:

Annotations for 1626243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720