FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626247_at:

>probe:Drosophila_2:1626247_at:130:607; Interrogation_Position=1335; Antisense; TGATGCTGAACATACTTCCACCCGG
>probe:Drosophila_2:1626247_at:445:135; Interrogation_Position=1361; Antisense; ACGAACGTGATTCCCTGGCTAGGAG
>probe:Drosophila_2:1626247_at:53:77; Interrogation_Position=1381; Antisense; AGGAGACCTGGAATCGCTGGGCTTC
>probe:Drosophila_2:1626247_at:295:95; Interrogation_Position=1426; Antisense; AGAGACGGCCAGTTTTCCGGTGCGT
>probe:Drosophila_2:1626247_at:709:411; Interrogation_Position=1454; Antisense; GACCGCAGATCTTATTCGCAGAGCA
>probe:Drosophila_2:1626247_at:47:591; Interrogation_Position=1482; Antisense; TGGTGTGGATACGACAGGCTAGCCT
>probe:Drosophila_2:1626247_at:422:617; Interrogation_Position=1506; Antisense; TGCAGTCCGACGTCCAGAAGGTACT
>probe:Drosophila_2:1626247_at:721:397; Interrogation_Position=1533; Antisense; GACACGCCAAGAAGATGCCCGACAA
>probe:Drosophila_2:1626247_at:537:211; Interrogation_Position=1556; Antisense; AAGACGCAGCACTTCTACAAGGAGC
>probe:Drosophila_2:1626247_at:226:11; Interrogation_Position=1615; Antisense; ATTCGTCGAGTTGCTGGAGGCTTTG
>probe:Drosophila_2:1626247_at:69:39; Interrogation_Position=1668; Antisense; ATCTCAGCCTGAACGGAGCCAGCAA
>probe:Drosophila_2:1626247_at:382:669; Interrogation_Position=1723; Antisense; TACGGAGTTGCGGAAGACCTCGAAC
>probe:Drosophila_2:1626247_at:626:51; Interrogation_Position=1754; Antisense; ATGAAGTCCATGATTGTTCCGCTCC
>probe:Drosophila_2:1626247_at:671:629; Interrogation_Position=1822; Antisense; TCCTGCTCCTGCATACATGTATTGA

Paste this into a BLAST search page for me
TGATGCTGAACATACTTCCACCCGGACGAACGTGATTCCCTGGCTAGGAGAGGAGACCTGGAATCGCTGGGCTTCAGAGACGGCCAGTTTTCCGGTGCGTGACCGCAGATCTTATTCGCAGAGCATGGTGTGGATACGACAGGCTAGCCTTGCAGTCCGACGTCCAGAAGGTACTGACACGCCAAGAAGATGCCCGACAAAAGACGCAGCACTTCTACAAGGAGCATTCGTCGAGTTGCTGGAGGCTTTGATCTCAGCCTGAACGGAGCCAGCAATACGGAGTTGCGGAAGACCTCGAACATGAAGTCCATGATTGTTCCGCTCCTCCTGCTCCTGCATACATGTATTGA

Full Affymetrix probeset data:

Annotations for 1626247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720