FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626248_at:

>probe:Drosophila_2:1626248_at:185:285; Interrogation_Position=1015; Antisense; CTGGAAATATATTGGGCGGCCCTGA
>probe:Drosophila_2:1626248_at:274:605; Interrogation_Position=473; Antisense; TGATCAACGAGACACTGCCCACTTT
>probe:Drosophila_2:1626248_at:364:95; Interrogation_Position=526; Antisense; AGATTCATTGGAGTGTCCGCTTACC
>probe:Drosophila_2:1626248_at:259:509; Interrogation_Position=559; Antisense; GTGCTTAAGGAGTTCCTGACCCGAA
>probe:Drosophila_2:1626248_at:658:561; Interrogation_Position=589; Antisense; GGAAGACTCGATACGGTCCTCACCT
>probe:Drosophila_2:1626248_at:173:49; Interrogation_Position=614; Antisense; ATGCCAGATACACCCTGACCGATGA
>probe:Drosophila_2:1626248_at:44:611; Interrogation_Position=629; Antisense; TGACCGATGAAACGCTCCTGGAGTA
>probe:Drosophila_2:1626248_at:391:349; Interrogation_Position=762; Antisense; GCAGAAGGCCATTGCCCGGAAGGCA
>probe:Drosophila_2:1626248_at:693:489; Interrogation_Position=834; Antisense; GTACTACACGATGAGCGGACTGCCC
>probe:Drosophila_2:1626248_at:197:221; Interrogation_Position=860; Antisense; AAGTGAGCACCTTCCTAACGGGCAT
>probe:Drosophila_2:1626248_at:454:53; Interrogation_Position=883; Antisense; ATGCAGACGCGCCAGTTGCTGCGAA
>probe:Drosophila_2:1626248_at:546:723; Interrogation_Position=898; Antisense; TTGCTGCGAATCAACCTGGATGCCA
>probe:Drosophila_2:1626248_at:307:627; Interrogation_Position=918; Antisense; TGCCAACGAAGTGGGCCTCAGCGAT
>probe:Drosophila_2:1626248_at:434:379; Interrogation_Position=987; Antisense; GAAGCCTTTCGATTGGGAGGGCAAC

Paste this into a BLAST search page for me
CTGGAAATATATTGGGCGGCCCTGATGATCAACGAGACACTGCCCACTTTAGATTCATTGGAGTGTCCGCTTACCGTGCTTAAGGAGTTCCTGACCCGAAGGAAGACTCGATACGGTCCTCACCTATGCCAGATACACCCTGACCGATGATGACCGATGAAACGCTCCTGGAGTAGCAGAAGGCCATTGCCCGGAAGGCAGTACTACACGATGAGCGGACTGCCCAAGTGAGCACCTTCCTAACGGGCATATGCAGACGCGCCAGTTGCTGCGAATTGCTGCGAATCAACCTGGATGCCATGCCAACGAAGTGGGCCTCAGCGATGAAGCCTTTCGATTGGGAGGGCAAC

Full Affymetrix probeset data:

Annotations for 1626248_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720