FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626250_at:

>probe:Drosophila_2:1626250_at:41:101; Interrogation_Position=366; Antisense; AGAGGCGGGACAACATCATCATCTA
>probe:Drosophila_2:1626250_at:50:267; Interrogation_Position=398; Antisense; CAGTGCCTGTATGCCTACAACGAGG
>probe:Drosophila_2:1626250_at:177:511; Interrogation_Position=427; Antisense; GTGCAAGTTCAAGTCGTTCCACGAG
>probe:Drosophila_2:1626250_at:292:667; Interrogation_Position=464; Antisense; TACATAAAGCGGACGGCGACACTCT
>probe:Drosophila_2:1626250_at:685:507; Interrogation_Position=529; Antisense; GTGCGAGCTGCATAAGCGCTTCGTG
>probe:Drosophila_2:1626250_at:261:621; Interrogation_Position=591; Antisense; TGCTGCCCTTTTTCAAACTGCTCAA
>probe:Drosophila_2:1626250_at:26:195; Interrogation_Position=606; Antisense; AACTGCTCAAGGATTCCGATCCGAA
>probe:Drosophila_2:1626250_at:644:669; Interrogation_Position=635; Antisense; TACTGCGAGTGCTGCTGTTTCAAGG
>probe:Drosophila_2:1626250_at:423:457; Interrogation_Position=660; Antisense; GATACGACTGGATGCCCAAGAGCAA
>probe:Drosophila_2:1626250_at:457:195; Interrogation_Position=762; Antisense; AACTGCACATTCATTCGCCGCAGGA
>probe:Drosophila_2:1626250_at:337:699; Interrogation_Position=797; Antisense; TTTATTGCCGCCTATCTGATGAATC
>probe:Drosophila_2:1626250_at:396:423; Interrogation_Position=848; Antisense; GAGAAGCTCGTGATTTTCCAAGCAG
>probe:Drosophila_2:1626250_at:367:419; Interrogation_Position=893; Antisense; GAGCTTTCGGATCCCACATTCAATT
>probe:Drosophila_2:1626250_at:168:435; Interrogation_Position=920; Antisense; GAGGATATTTGTCCGAAGCCTGAAT

Paste this into a BLAST search page for me
AGAGGCGGGACAACATCATCATCTACAGTGCCTGTATGCCTACAACGAGGGTGCAAGTTCAAGTCGTTCCACGAGTACATAAAGCGGACGGCGACACTCTGTGCGAGCTGCATAAGCGCTTCGTGTGCTGCCCTTTTTCAAACTGCTCAAAACTGCTCAAGGATTCCGATCCGAATACTGCGAGTGCTGCTGTTTCAAGGGATACGACTGGATGCCCAAGAGCAAAACTGCACATTCATTCGCCGCAGGATTTATTGCCGCCTATCTGATGAATCGAGAAGCTCGTGATTTTCCAAGCAGGAGCTTTCGGATCCCACATTCAATTGAGGATATTTGTCCGAAGCCTGAAT

Full Affymetrix probeset data:

Annotations for 1626250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720