Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626251_at:

>probe:Drosophila_2:1626251_at:399:579; Interrogation_Position=1290; Antisense; GGCCATGTCTTCAGCCACGAAAAGG
>probe:Drosophila_2:1626251_at:599:225; Interrogation_Position=1311; Antisense; AAGGCCCTACGGGAGCAGGCCAAGA
>probe:Drosophila_2:1626251_at:567:87; Interrogation_Position=1348; Antisense; AGTCGCTGCGCTCCAATGTGGACAA
>probe:Drosophila_2:1626251_at:585:719; Interrogation_Position=1399; Antisense; TTGCGAAGGCGGCTATCACCATCTG
>probe:Drosophila_2:1626251_at:177:603; Interrogation_Position=1429; Antisense; TGTTCTTCGTGTCGTGGACGCCCTA
>probe:Drosophila_2:1626251_at:513:321; Interrogation_Position=1448; Antisense; GCCCTACGGCGTAATGTCGCTGATC
>probe:Drosophila_2:1626251_at:440:213; Interrogation_Position=1488; Antisense; AAGAGTCTGCTTACACCAGGAGCCA
>probe:Drosophila_2:1626251_at:728:195; Interrogation_Position=1537; Antisense; AACTGGTGGCGTGCATAGACCCATT
>probe:Drosophila_2:1626251_at:321:103; Interrogation_Position=1553; Antisense; AGACCCATTCGTCTATGCCATAAGT
>probe:Drosophila_2:1626251_at:377:645; Interrogation_Position=1564; Antisense; TCTATGCCATAAGTCACCCCAGATA
>probe:Drosophila_2:1626251_at:182:205; Interrogation_Position=1605; Antisense; AAGCGCTGTCCCTGGCTGGGAGTCA
>probe:Drosophila_2:1626251_at:541:527; Interrogation_Position=1642; Antisense; GGGAGATCTCTTCGGCGCAGTCCAC
>probe:Drosophila_2:1626251_at:699:403; Interrogation_Position=1688; Antisense; GACTACCGCTGCATAGAACCAAGGA
>probe:Drosophila_2:1626251_at:441:379; Interrogation_Position=1703; Antisense; GAACCAAGGACAACTCTACTCTAAG

Paste this into a BLAST search page for me
GGCCATGTCTTCAGCCACGAAAAGGAAGGCCCTACGGGAGCAGGCCAAGAAGTCGCTGCGCTCCAATGTGGACAATTGCGAAGGCGGCTATCACCATCTGTGTTCTTCGTGTCGTGGACGCCCTAGCCCTACGGCGTAATGTCGCTGATCAAGAGTCTGCTTACACCAGGAGCCAAACTGGTGGCGTGCATAGACCCATTAGACCCATTCGTCTATGCCATAAGTTCTATGCCATAAGTCACCCCAGATAAAGCGCTGTCCCTGGCTGGGAGTCAGGGAGATCTCTTCGGCGCAGTCCACGACTACCGCTGCATAGAACCAAGGAGAACCAAGGACAACTCTACTCTAAG

Full Affymetrix probeset data:

Annotations for 1626251_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime