FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626253_at:

>probe:Drosophila_2:1626253_at:473:561; Interrogation_Position=171; Antisense; GGAACACCTCAAGCCAGAATTCCTT
>probe:Drosophila_2:1626253_at:520:105; Interrogation_Position=186; Antisense; AGAATTCCTTAAGCTCAATCCCCAG
>probe:Drosophila_2:1626253_at:492:65; Interrogation_Position=236; Antisense; ATGGATTCGCCATTTGGGAGTCCCG
>probe:Drosophila_2:1626253_at:88:59; Interrogation_Position=317; Antisense; ATGATCCCCAGAAACGCGCATTGAT
>probe:Drosophila_2:1626253_at:546:201; Interrogation_Position=369; Antisense; AACCCTGCATGACTCCTTTATGAAG
>probe:Drosophila_2:1626253_at:495:373; Interrogation_Position=390; Antisense; GAAGTACTATTACCCATTCATCCGT
>probe:Drosophila_2:1626253_at:110:13; Interrogation_Position=405; Antisense; ATTCATCCGTACTGGTCAGCTTGGG
>probe:Drosophila_2:1626253_at:367:537; Interrogation_Position=418; Antisense; GGTCAGCTTGGGAATGCCGAGAATT
>probe:Drosophila_2:1626253_at:487:297; Interrogation_Position=453; Antisense; CGAAGCTGCCTTTGAATTCCTGGAC
>probe:Drosophila_2:1626253_at:167:401; Interrogation_Position=475; Antisense; GACATTTTCTTGGAGGGCCAGGACT
>probe:Drosophila_2:1626253_at:213:487; Interrogation_Position=509; Antisense; GTAGCCAGCTAACTGTGGCCGACAT
>probe:Drosophila_2:1626253_at:549:253; Interrogation_Position=621; Antisense; CAAAAAGATCACACCCGGATGGGAT
>probe:Drosophila_2:1626253_at:163:181; Interrogation_Position=647; Antisense; AAAACTGGAAGGGTCTGCTACAAAT
>probe:Drosophila_2:1626253_at:477:487; Interrogation_Position=681; Antisense; GTACGAAGCCCAAAAGGCCTCATTA

Paste this into a BLAST search page for me
GGAACACCTCAAGCCAGAATTCCTTAGAATTCCTTAAGCTCAATCCCCAGATGGATTCGCCATTTGGGAGTCCCGATGATCCCCAGAAACGCGCATTGATAACCCTGCATGACTCCTTTATGAAGGAAGTACTATTACCCATTCATCCGTATTCATCCGTACTGGTCAGCTTGGGGGTCAGCTTGGGAATGCCGAGAATTCGAAGCTGCCTTTGAATTCCTGGACGACATTTTCTTGGAGGGCCAGGACTGTAGCCAGCTAACTGTGGCCGACATCAAAAAGATCACACCCGGATGGGATAAAACTGGAAGGGTCTGCTACAAATGTACGAAGCCCAAAAGGCCTCATTA

Full Affymetrix probeset data:

Annotations for 1626253_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720