Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626254_s_at:

>probe:Drosophila_2:1626254_s_at:212:431; Interrogation_Position=337; Antisense; GAGTCACCCGTCGTCCAACGATGGG
>probe:Drosophila_2:1626254_s_at:714:543; Interrogation_Position=384; Antisense; GGATCACGAGCACTCAACTGTGGCC
>probe:Drosophila_2:1626254_s_at:585:195; Interrogation_Position=399; Antisense; AACTGTGGCCTGTTGATGCTCCTGC
>probe:Drosophila_2:1626254_s_at:156:271; Interrogation_Position=473; Antisense; CATGCAGGCGCCACAGAAACGAGGT
>probe:Drosophila_2:1626254_s_at:343:83; Interrogation_Position=555; Antisense; AGTGGCAGCTCGTCGGACGTATCGA
>probe:Drosophila_2:1626254_s_at:71:409; Interrogation_Position=570; Antisense; GACGTATCGAGAGATCACTGCAACA
>probe:Drosophila_2:1626254_s_at:306:253; Interrogation_Position=593; Antisense; CAAGACGGTGGACATCTTCGAGGAC
>probe:Drosophila_2:1626254_s_at:502:437; Interrogation_Position=612; Antisense; GAGGACATCAGCTCGCCGGAGGTCA
>probe:Drosophila_2:1626254_s_at:136:495; Interrogation_Position=633; Antisense; GTCAGCAACCAGAACGTGGGTCGTC
>probe:Drosophila_2:1626254_s_at:535:325; Interrogation_Position=703; Antisense; GCGACTTTGTGCTGCGTCTGCGATT
>probe:Drosophila_2:1626254_s_at:488:623; Interrogation_Position=715; Antisense; TGCGTCTGCGATTCAAGAAGTTCAA
>probe:Drosophila_2:1626254_s_at:693:101; Interrogation_Position=730; Antisense; AGAAGTTCAAAGTGGGTCAGCTGCT
>probe:Drosophila_2:1626254_s_at:595:495; Interrogation_Position=745; Antisense; GTCAGCTGCTGAATGCAACCCACTG
>probe:Drosophila_2:1626254_s_at:628:199; Interrogation_Position=761; Antisense; AACCCACTGCGAGGGCGGCTACTTG

Paste this into a BLAST search page for me
GAGTCACCCGTCGTCCAACGATGGGGGATCACGAGCACTCAACTGTGGCCAACTGTGGCCTGTTGATGCTCCTGCCATGCAGGCGCCACAGAAACGAGGTAGTGGCAGCTCGTCGGACGTATCGAGACGTATCGAGAGATCACTGCAACACAAGACGGTGGACATCTTCGAGGACGAGGACATCAGCTCGCCGGAGGTCAGTCAGCAACCAGAACGTGGGTCGTCGCGACTTTGTGCTGCGTCTGCGATTTGCGTCTGCGATTCAAGAAGTTCAAAGAAGTTCAAAGTGGGTCAGCTGCTGTCAGCTGCTGAATGCAACCCACTGAACCCACTGCGAGGGCGGCTACTTG

Full Affymetrix probeset data:

Annotations for 1626254_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime