FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626255_at:

>probe:Drosophila_2:1626255_at:666:669; Interrogation_Position=1012; Antisense; TACGTTTACTTCTGGTACTCGCTGA
>probe:Drosophila_2:1626255_at:416:589; Interrogation_Position=1061; Antisense; TGGTTTTCATGACTGCCTCCAAGAT
>probe:Drosophila_2:1626255_at:297:607; Interrogation_Position=1109; Antisense; TGAGGTCCTTGTACTTGGTGCCCAG
>probe:Drosophila_2:1626255_at:581:509; Interrogation_Position=1153; Antisense; GTGCAGAGATTTGCCGACCAGCTGA
>probe:Drosophila_2:1626255_at:358:23; Interrogation_Position=1203; Antisense; ATATCGTCTCTTCTGCTTGACAAGA
>probe:Drosophila_2:1626255_at:530:99; Interrogation_Position=1229; Antisense; AGAGTCTCTTCGGAATGCTAGCCAC
>probe:Drosophila_2:1626255_at:124:535; Interrogation_Position=1257; Antisense; GGTGACCTACGAACTTATGCTGCTG
>probe:Drosophila_2:1626255_at:543:141; Interrogation_Position=822; Antisense; ACTGGAGGGTCGTCATGTTCCCGAA
>probe:Drosophila_2:1626255_at:240:379; Interrogation_Position=844; Antisense; GAAGCCTTGTGGTACGACATTCGGA
>probe:Drosophila_2:1626255_at:566:433; Interrogation_Position=867; Antisense; GAGGGATCACATTCGCCTTTGCGAG
>probe:Drosophila_2:1626255_at:300:363; Interrogation_Position=921; Antisense; GAATATAGTGTTCGTATCCTGCGCT
>probe:Drosophila_2:1626255_at:91:485; Interrogation_Position=954; Antisense; GTATGTGATCTGCAACCAGGCGTTG
>probe:Drosophila_2:1626255_at:442:583; Interrogation_Position=977; Antisense; TGGCTATTTTCACCAAACTGCGGCA
>probe:Drosophila_2:1626255_at:409:621; Interrogation_Position=995; Antisense; TGCGGCATCCCATAAACTACGTTTA

Paste this into a BLAST search page for me
TACGTTTACTTCTGGTACTCGCTGATGGTTTTCATGACTGCCTCCAAGATTGAGGTCCTTGTACTTGGTGCCCAGGTGCAGAGATTTGCCGACCAGCTGAATATCGTCTCTTCTGCTTGACAAGAAGAGTCTCTTCGGAATGCTAGCCACGGTGACCTACGAACTTATGCTGCTGACTGGAGGGTCGTCATGTTCCCGAAGAAGCCTTGTGGTACGACATTCGGAGAGGGATCACATTCGCCTTTGCGAGGAATATAGTGTTCGTATCCTGCGCTGTATGTGATCTGCAACCAGGCGTTGTGGCTATTTTCACCAAACTGCGGCATGCGGCATCCCATAAACTACGTTTA

Full Affymetrix probeset data:

Annotations for 1626255_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720