Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626259_at:

>probe:Drosophila_2:1626259_at:528:437; Interrogation_Position=4322; Antisense; GAGGAGCTGGCGTCATGAACAACAT
>probe:Drosophila_2:1626259_at:523:523; Interrogation_Position=4365; Antisense; GGGCATGGGCTTCAATAACTTCAAC
>probe:Drosophila_2:1626259_at:566:161; Interrogation_Position=4451; Antisense; ACAATCGCAACCAGCGAGGCGGCAA
>probe:Drosophila_2:1626259_at:497:389; Interrogation_Position=4481; Antisense; GAAACCGCAACATTTAAAGGCCCAT
>probe:Drosophila_2:1626259_at:381:227; Interrogation_Position=4497; Antisense; AAGGCCCATGCGTTGCGAAAACACA
>probe:Drosophila_2:1626259_at:333:701; Interrogation_Position=4538; Antisense; TTTTGCCCCAATGATCTTAAAGCGA
>probe:Drosophila_2:1626259_at:127:205; Interrogation_Position=4557; Antisense; AAGCGATGCTATGCCACATGACCCT
>probe:Drosophila_2:1626259_at:191:259; Interrogation_Position=4597; Antisense; CATACGTCGTGGAAAACTCGTGGTT
>probe:Drosophila_2:1626259_at:246:387; Interrogation_Position=4639; Antisense; GAAAATCCAGGCATGACTCCTTGTA
>probe:Drosophila_2:1626259_at:285:59; Interrogation_Position=4665; Antisense; ATGTATTTTATTCCCGAATCCCCAT
>probe:Drosophila_2:1626259_at:578:367; Interrogation_Position=4680; Antisense; GAATCCCCATTATTGTCACTATTTT
>probe:Drosophila_2:1626259_at:585:699; Interrogation_Position=4702; Antisense; TTTTTTCGCTAGGTGTAAGGATCTT
>probe:Drosophila_2:1626259_at:631:227; Interrogation_Position=4794; Antisense; AATGGTATGCGCAGCCCTTTTTAAC
>probe:Drosophila_2:1626259_at:448:655; Interrogation_Position=4842; Antisense; TAATTTGTTCAATAGCGCGAGTACT

Paste this into a BLAST search page for me
GAGGAGCTGGCGTCATGAACAACATGGGCATGGGCTTCAATAACTTCAACACAATCGCAACCAGCGAGGCGGCAAGAAACCGCAACATTTAAAGGCCCATAAGGCCCATGCGTTGCGAAAACACATTTTGCCCCAATGATCTTAAAGCGAAAGCGATGCTATGCCACATGACCCTCATACGTCGTGGAAAACTCGTGGTTGAAAATCCAGGCATGACTCCTTGTAATGTATTTTATTCCCGAATCCCCATGAATCCCCATTATTGTCACTATTTTTTTTTTCGCTAGGTGTAAGGATCTTAATGGTATGCGCAGCCCTTTTTAACTAATTTGTTCAATAGCGCGAGTACT

Full Affymetrix probeset data:

Annotations for 1626259_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime