FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626260_at:

>probe:Drosophila_2:1626260_at:380:43; Interrogation_Position=1040; Antisense; ATCCGGCCGTACATCGAAATACTGA
>probe:Drosophila_2:1626260_at:408:29; Interrogation_Position=1058; Antisense; ATACTGACCGTCAGCGAGTTGCACG
>probe:Drosophila_2:1626260_at:539:341; Interrogation_Position=1158; Antisense; GCTTTCTTATCGCAGCCAGCGTAAT
>probe:Drosophila_2:1626260_at:572:119; Interrogation_Position=1175; Antisense; AGCGTAATGGCTGCTCCGGGTTCAC
>probe:Drosophila_2:1626260_at:54:439; Interrogation_Position=1232; Antisense; GAGGAATCTCTGACCAGGTCCGACA
>probe:Drosophila_2:1626260_at:312:27; Interrogation_Position=1281; Antisense; ATACGTCTATTTTGGATGCGGCCGC
>probe:Drosophila_2:1626260_at:695:353; Interrogation_Position=1319; Antisense; GCAGCCTTGTTGATTGTGCTCGGAA
>probe:Drosophila_2:1626260_at:598:367; Interrogation_Position=1341; Antisense; GAATCGTCTCGAATATCATCGCCTT
>probe:Drosophila_2:1626260_at:288:5; Interrogation_Position=1373; Antisense; ATTGTGTTCTTCCTAGACGCTGTAA
>probe:Drosophila_2:1626260_at:156:5; Interrogation_Position=1418; Antisense; ATTGGACTGCATAACATCACCCTAC
>probe:Drosophila_2:1626260_at:40:39; Interrogation_Position=1460; Antisense; ATCTTTATCCCGATTGTCTTCGTGA
>probe:Drosophila_2:1626260_at:367:507; Interrogation_Position=1490; Antisense; GTGCCGTGGCACGATTGTCAAGCAA
>probe:Drosophila_2:1626260_at:477:363; Interrogation_Position=1511; Antisense; GCAATTGGCCTGGTGGTGGCCCAAA
>probe:Drosophila_2:1626260_at:19:91; Interrogation_Position=1607; Antisense; AGTACCCATCTGCATATTCTATTCT

Paste this into a BLAST search page for me
ATCCGGCCGTACATCGAAATACTGAATACTGACCGTCAGCGAGTTGCACGGCTTTCTTATCGCAGCCAGCGTAATAGCGTAATGGCTGCTCCGGGTTCACGAGGAATCTCTGACCAGGTCCGACAATACGTCTATTTTGGATGCGGCCGCGCAGCCTTGTTGATTGTGCTCGGAAGAATCGTCTCGAATATCATCGCCTTATTGTGTTCTTCCTAGACGCTGTAAATTGGACTGCATAACATCACCCTACATCTTTATCCCGATTGTCTTCGTGAGTGCCGTGGCACGATTGTCAAGCAAGCAATTGGCCTGGTGGTGGCCCAAAAGTACCCATCTGCATATTCTATTCT

Full Affymetrix probeset data:

Annotations for 1626260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720