Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626263_at:

>probe:Drosophila_2:1626263_at:649:401; Interrogation_Position=3350; Antisense; GACATCTGGTCGATGGCCGGGTTTT
>probe:Drosophila_2:1626263_at:612:67; Interrogation_Position=3362; Antisense; ATGGCCGGGTTTTGCGACACATAAA
>probe:Drosophila_2:1626263_at:226:179; Interrogation_Position=3384; Antisense; AAACAACGTTTATCACTTTGAGGAT
>probe:Drosophila_2:1626263_at:205:437; Interrogation_Position=3403; Antisense; GAGGATAAGCTGCTGCTCTACAATT
>probe:Drosophila_2:1626263_at:527:337; Interrogation_Position=3417; Antisense; GCTCTACAATTTCTGCAGTCGCATA
>probe:Drosophila_2:1626263_at:295:503; Interrogation_Position=3434; Antisense; GTCGCATATAGATGCAGCCACTGTA
>probe:Drosophila_2:1626263_at:424:579; Interrogation_Position=3474; Antisense; GGCCAAATTTAGCTTGATTTCCTGT
>probe:Drosophila_2:1626263_at:514:405; Interrogation_Position=3523; Antisense; GACTGCTGTGATTGTACGCCAAACA
>probe:Drosophila_2:1626263_at:218:381; Interrogation_Position=3549; Antisense; GAACGCACACACAATGCAGTCAGTT
>probe:Drosophila_2:1626263_at:419:145; Interrogation_Position=3689; Antisense; ACTAAGTAGTTGACTCAGCTAGAGC
>probe:Drosophila_2:1626263_at:497:117; Interrogation_Position=3705; Antisense; AGCTAGAGCTTTATGCAGTGCAATA
>probe:Drosophila_2:1626263_at:147:365; Interrogation_Position=3775; Antisense; GAATAACTTTGTACTTTAAGCGCAA
>probe:Drosophila_2:1626263_at:136:709; Interrogation_Position=3790; Antisense; TTAAGCGCAATTCTGTGTCACAACT
>probe:Drosophila_2:1626263_at:560:721; Interrogation_Position=3910; Antisense; TTGCATATATACCTCAAGCCGCGAG

Paste this into a BLAST search page for me
GACATCTGGTCGATGGCCGGGTTTTATGGCCGGGTTTTGCGACACATAAAAAACAACGTTTATCACTTTGAGGATGAGGATAAGCTGCTGCTCTACAATTGCTCTACAATTTCTGCAGTCGCATAGTCGCATATAGATGCAGCCACTGTAGGCCAAATTTAGCTTGATTTCCTGTGACTGCTGTGATTGTACGCCAAACAGAACGCACACACAATGCAGTCAGTTACTAAGTAGTTGACTCAGCTAGAGCAGCTAGAGCTTTATGCAGTGCAATAGAATAACTTTGTACTTTAAGCGCAATTAAGCGCAATTCTGTGTCACAACTTTGCATATATACCTCAAGCCGCGAG

Full Affymetrix probeset data:

Annotations for 1626263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime