FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626264_at:

>probe:Drosophila_2:1626264_at:161:455; Interrogation_Position=1020; Antisense; GATCACAGCCCATCAGTACGGTGAG
>probe:Drosophila_2:1626264_at:400:487; Interrogation_Position=1035; Antisense; GTACGGTGAGGTCTTCTGGACCAAC
>probe:Drosophila_2:1626264_at:8:581; Interrogation_Position=1067; Antisense; TGGCCACGAGGTGTCTTCTTTGCGT
>probe:Drosophila_2:1626264_at:236:715; Interrogation_Position=1082; Antisense; TTCTTTGCGTTGTCTTCAGCAGCGA
>probe:Drosophila_2:1626264_at:614:113; Interrogation_Position=1099; Antisense; AGCAGCGATGAGTTGGCTACCCACA
>probe:Drosophila_2:1626264_at:560:173; Interrogation_Position=1173; Antisense; AAAGCTCCAGTTAGACCAACGCAAG
>probe:Drosophila_2:1626264_at:214:297; Interrogation_Position=1203; Antisense; CGACATCGTGGTCTGTGTGAGAAAC
>probe:Drosophila_2:1626264_at:497:73; Interrogation_Position=1241; Antisense; AGGAACGGGTGATTCGGGCCACCAT
>probe:Drosophila_2:1626264_at:322:147; Interrogation_Position=1267; Antisense; ACTACCAAGTGTGCGGATACCGCCA
>probe:Drosophila_2:1626264_at:125:111; Interrogation_Position=1313; Antisense; AGAAGGCCCAGAAGGTCGCCATCAA
>probe:Drosophila_2:1626264_at:726:277; Interrogation_Position=1387; Antisense; CTATGATCAAGCTCTTCTCAACGAC
>probe:Drosophila_2:1626264_at:220:483; Interrogation_Position=1439; Antisense; GTATATATTCGTAGTAGGTCCTGCT
>probe:Drosophila_2:1626264_at:393:393; Interrogation_Position=936; Antisense; GAAAGACACTCTTGTGCAGTACCCG
>probe:Drosophila_2:1626264_at:371:505; Interrogation_Position=986; Antisense; GTGCGGTGTACGTACTGGGACCCAA

Paste this into a BLAST search page for me
GATCACAGCCCATCAGTACGGTGAGGTACGGTGAGGTCTTCTGGACCAACTGGCCACGAGGTGTCTTCTTTGCGTTTCTTTGCGTTGTCTTCAGCAGCGAAGCAGCGATGAGTTGGCTACCCACAAAAGCTCCAGTTAGACCAACGCAAGCGACATCGTGGTCTGTGTGAGAAACAGGAACGGGTGATTCGGGCCACCATACTACCAAGTGTGCGGATACCGCCAAGAAGGCCCAGAAGGTCGCCATCAACTATGATCAAGCTCTTCTCAACGACGTATATATTCGTAGTAGGTCCTGCTGAAAGACACTCTTGTGCAGTACCCGGTGCGGTGTACGTACTGGGACCCAA

Full Affymetrix probeset data:

Annotations for 1626264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720