FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626266_at:

>probe:Drosophila_2:1626266_at:566:481; Interrogation_Position=357; Antisense; GTATAATACTAACCCCACTGGACGC
>probe:Drosophila_2:1626266_at:134:213; Interrogation_Position=389; Antisense; AAGACGTTCATCTGCACTGCGGAGG
>probe:Drosophila_2:1626266_at:516:473; Interrogation_Position=460; Antisense; GTTCACGCTGCTGTATATTATTCTC
>probe:Drosophila_2:1626266_at:455:703; Interrogation_Position=477; Antisense; TTATTCTCATGTACATCTTCCTGCG
>probe:Drosophila_2:1626266_at:330:331; Interrogation_Position=501; Antisense; GCGGCAACCGCATCGAGGACTCGAA
>probe:Drosophila_2:1626266_at:172:487; Interrogation_Position=529; Antisense; GTACGTTATGCTGGAGATGCTCAAC
>probe:Drosophila_2:1626266_at:270:447; Interrogation_Position=544; Antisense; GATGCTCAACATCTATCCAGACGAA
>probe:Drosophila_2:1626266_at:299:375; Interrogation_Position=566; Antisense; GAAGAACATGGCTACTTCGGCCCCA
>probe:Drosophila_2:1626266_at:183:329; Interrogation_Position=640; Antisense; GCGGGAACGCTCACAGCTAAGTGCT
>probe:Drosophila_2:1626266_at:586:117; Interrogation_Position=654; Antisense; AGCTAAGTGCTTACGATGATTCCAA
>probe:Drosophila_2:1626266_at:166:465; Interrogation_Position=671; Antisense; GATTCCAAGACTTTCTTCCTTTGGG
>probe:Drosophila_2:1626266_at:456:227; Interrogation_Position=707; Antisense; AAGGCGGAGTTCACATTCGAGCAAA
>probe:Drosophila_2:1626266_at:528:357; Interrogation_Position=727; Antisense; GCAAATGGTGCAATTCGCCTCCAAG
>probe:Drosophila_2:1626266_at:7:207; Interrogation_Position=749; Antisense; AAGCTGCTCAATCAGCATCCCAAGG

Paste this into a BLAST search page for me
GTATAATACTAACCCCACTGGACGCAAGACGTTCATCTGCACTGCGGAGGGTTCACGCTGCTGTATATTATTCTCTTATTCTCATGTACATCTTCCTGCGGCGGCAACCGCATCGAGGACTCGAAGTACGTTATGCTGGAGATGCTCAACGATGCTCAACATCTATCCAGACGAAGAAGAACATGGCTACTTCGGCCCCAGCGGGAACGCTCACAGCTAAGTGCTAGCTAAGTGCTTACGATGATTCCAAGATTCCAAGACTTTCTTCCTTTGGGAAGGCGGAGTTCACATTCGAGCAAAGCAAATGGTGCAATTCGCCTCCAAGAAGCTGCTCAATCAGCATCCCAAGG

Full Affymetrix probeset data:

Annotations for 1626266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720