FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626271_at:

>probe:Drosophila_2:1626271_at:254:93; Interrogation_Position=3080; Antisense; AGTTATCTCTTTAACGCCACATGGC
>probe:Drosophila_2:1626271_at:705:67; Interrogation_Position=3100; Antisense; ATGGCAGCATATCCAGTTTCTACCC
>probe:Drosophila_2:1626271_at:297:131; Interrogation_Position=3165; Antisense; ACCTGCTCTGAGATGCGATTTTCCA
>probe:Drosophila_2:1626271_at:650:101; Interrogation_Position=3214; Antisense; AGAGCCCTGTGGATGAACCGGATGA
>probe:Drosophila_2:1626271_at:132:445; Interrogation_Position=3234; Antisense; GATGATGATGTCCTTCGGCAGCTGC
>probe:Drosophila_2:1626271_at:541:119; Interrogation_Position=3253; Antisense; AGCTGCGAAACGGAACAACCTATTT
>probe:Drosophila_2:1626271_at:118:699; Interrogation_Position=3290; Antisense; TTTTACTCCCACACATTGCCAGAGA
>probe:Drosophila_2:1626271_at:489:257; Interrogation_Position=3376; Antisense; CACACATCGCCCTAGTTGTAGTTTA
>probe:Drosophila_2:1626271_at:158:127; Interrogation_Position=3408; Antisense; AGCCTAGCACGTAGCTTAACCATGA
>probe:Drosophila_2:1626271_at:206:403; Interrogation_Position=3440; Antisense; GACTTGACATTGACTAGCCACTGTT
>probe:Drosophila_2:1626271_at:98:717; Interrogation_Position=3481; Antisense; TTCGCAATCTGCTCCAATTGGACAC
>probe:Drosophila_2:1626271_at:696:377; Interrogation_Position=3543; Antisense; GAACCCTACGCCTAGTTTAGTCTAG
>probe:Drosophila_2:1626271_at:223:679; Interrogation_Position=3584; Antisense; TAGTTAGTTGCTAAGCGCCGTCTGC
>probe:Drosophila_2:1626271_at:2:293; Interrogation_Position=3602; Antisense; CGTCTGCCACCCTGTATAAATTGAT

Paste this into a BLAST search page for me
AGTTATCTCTTTAACGCCACATGGCATGGCAGCATATCCAGTTTCTACCCACCTGCTCTGAGATGCGATTTTCCAAGAGCCCTGTGGATGAACCGGATGAGATGATGATGTCCTTCGGCAGCTGCAGCTGCGAAACGGAACAACCTATTTTTTTACTCCCACACATTGCCAGAGACACACATCGCCCTAGTTGTAGTTTAAGCCTAGCACGTAGCTTAACCATGAGACTTGACATTGACTAGCCACTGTTTTCGCAATCTGCTCCAATTGGACACGAACCCTACGCCTAGTTTAGTCTAGTAGTTAGTTGCTAAGCGCCGTCTGCCGTCTGCCACCCTGTATAAATTGAT

Full Affymetrix probeset data:

Annotations for 1626271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720