FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626273_at:

>probe:Drosophila_2:1626273_at:260:445; Interrogation_Position=2146; Antisense; GATGAACGCCTTGCGGGAATCAACG
>probe:Drosophila_2:1626273_at:454:31; Interrogation_Position=2164; Antisense; ATCAACGCATTGTCGGTACACCAAC
>probe:Drosophila_2:1626273_at:649:639; Interrogation_Position=2176; Antisense; TCGGTACACCAACAGGGAGCCCATA
>probe:Drosophila_2:1626273_at:112:555; Interrogation_Position=2191; Antisense; GGAGCCCATATATCGCAATTGCAAT
>probe:Drosophila_2:1626273_at:99:361; Interrogation_Position=2218; Antisense; GCAAGCGTGTGCAGAAGTTCCGAAA
>probe:Drosophila_2:1626273_at:59:373; Interrogation_Position=2246; Antisense; GAAGTGACTCCAGTCTGTGCGGATA
>probe:Drosophila_2:1626273_at:569:657; Interrogation_Position=2269; Antisense; TAAGTTCTCTAATTGCCAGTGGGCT
>probe:Drosophila_2:1626273_at:251:267; Interrogation_Position=2285; Antisense; CAGTGGGCTTCGCAGGCAAAGTTAT
>probe:Drosophila_2:1626273_at:202:655; Interrogation_Position=2332; Antisense; TAATTGTTGTTTTTCCTGCACGGGT
>probe:Drosophila_2:1626273_at:229:519; Interrogation_Position=2355; Antisense; GTGGCATTTAAAGTTCGTAGTTCGT
>probe:Drosophila_2:1626273_at:469:15; Interrogation_Position=2409; Antisense; ATTTAACCGCCGTGCAGAATAGCTA
>probe:Drosophila_2:1626273_at:341:243; Interrogation_Position=2442; Antisense; AATATTATCAAGCTTTACCCCACGC
>probe:Drosophila_2:1626273_at:208:669; Interrogation_Position=2457; Antisense; TACCCCACGCATTTGACATTTTGTT
>probe:Drosophila_2:1626273_at:653:197; Interrogation_Position=2679; Antisense; AACGATGTTGTTTCATACGCAACCA

Paste this into a BLAST search page for me
GATGAACGCCTTGCGGGAATCAACGATCAACGCATTGTCGGTACACCAACTCGGTACACCAACAGGGAGCCCATAGGAGCCCATATATCGCAATTGCAATGCAAGCGTGTGCAGAAGTTCCGAAAGAAGTGACTCCAGTCTGTGCGGATATAAGTTCTCTAATTGCCAGTGGGCTCAGTGGGCTTCGCAGGCAAAGTTATTAATTGTTGTTTTTCCTGCACGGGTGTGGCATTTAAAGTTCGTAGTTCGTATTTAACCGCCGTGCAGAATAGCTAAATATTATCAAGCTTTACCCCACGCTACCCCACGCATTTGACATTTTGTTAACGATGTTGTTTCATACGCAACCA

Full Affymetrix probeset data:

Annotations for 1626273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720