FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626275_at:

>probe:Drosophila_2:1626275_at:539:503; Interrogation_Position=168; Antisense; GTCCCGCGGTATTTCCGATGTTAGG
>probe:Drosophila_2:1626275_at:699:629; Interrogation_Position=181; Antisense; TCCGATGTTAGGTTTAAGTTAGTCT
>probe:Drosophila_2:1626275_at:637:475; Interrogation_Position=198; Antisense; GTTAGTCTTAATTTACAAGTGCGAG
>probe:Drosophila_2:1626275_at:151:621; Interrogation_Position=217; Antisense; TGCGAGAATAAAGTGCAACCAATTG
>probe:Drosophila_2:1626275_at:212:359; Interrogation_Position=231; Antisense; GCAACCAATTGAAGGCGATTCCGGA
>probe:Drosophila_2:1626275_at:350:71; Interrogation_Position=243; Antisense; AGGCGATTCCGGACGTTTCATTTCT
>probe:Drosophila_2:1626275_at:331:305; Interrogation_Position=251; Antisense; CCGGACGTTTCATTTCTGGAGGAAT
>probe:Drosophila_2:1626275_at:372:715; Interrogation_Position=264; Antisense; TTCTGGAGGAATTAGCCGCAACAAC
>probe:Drosophila_2:1626275_at:599:321; Interrogation_Position=276; Antisense; TAGCCGCAACAACAAACAATTCCGC
>probe:Drosophila_2:1626275_at:639:717; Interrogation_Position=320; Antisense; TTCGAGCCGGATATTTCGAGTCCGC
>probe:Drosophila_2:1626275_at:37:543; Interrogation_Position=328; Antisense; GGATATTTCGAGTCCGCGATACATC
>probe:Drosophila_2:1626275_at:136:433; Interrogation_Position=337; Antisense; GAGTCCGCGATACATCCTGATCCTG
>probe:Drosophila_2:1626275_at:160:517; Interrogation_Position=418; Antisense; GTGGTCACCATTCTCGTTTTTCCAA
>probe:Drosophila_2:1626275_at:539:261; Interrogation_Position=423; Antisense; CACCATTCTCGTTTTTCCAACGGCG

Paste this into a BLAST search page for me
GTCCCGCGGTATTTCCGATGTTAGGTCCGATGTTAGGTTTAAGTTAGTCTGTTAGTCTTAATTTACAAGTGCGAGTGCGAGAATAAAGTGCAACCAATTGGCAACCAATTGAAGGCGATTCCGGAAGGCGATTCCGGACGTTTCATTTCTCCGGACGTTTCATTTCTGGAGGAATTTCTGGAGGAATTAGCCGCAACAACTAGCCGCAACAACAAACAATTCCGCTTCGAGCCGGATATTTCGAGTCCGCGGATATTTCGAGTCCGCGATACATCGAGTCCGCGATACATCCTGATCCTGGTGGTCACCATTCTCGTTTTTCCAACACCATTCTCGTTTTTCCAACGGCG

Full Affymetrix probeset data:

Annotations for 1626275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720