FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626278_at:

>probe:Drosophila_2:1626278_at:52:689; Interrogation_Position=437; Antisense; TATTGTCGTGAAGCCGGGTCAGGTC
>probe:Drosophila_2:1626278_at:289:439; Interrogation_Position=504; Antisense; GAGGCGGACGCCAATAAGCTGTACA
>probe:Drosophila_2:1626278_at:248:241; Interrogation_Position=516; Antisense; AATAAGCTGTACACCCTCTGCATGA
>probe:Drosophila_2:1626278_at:543:151; Interrogation_Position=607; Antisense; ACATACCCGGTGGAGATGTCGCCAA
>probe:Drosophila_2:1626278_at:396:557; Interrogation_Position=681; Antisense; GGACTCCATCGTTACGTTTTCCTGA
>probe:Drosophila_2:1626278_at:519:669; Interrogation_Position=693; Antisense; TACGTTTTCCTGATCTACGAGCAGC
>probe:Drosophila_2:1626278_at:1:123; Interrogation_Position=715; Antisense; AGCGGTGCAAGCTCACATTCGACGA
>probe:Drosophila_2:1626278_at:327:11; Interrogation_Position=731; Antisense; ATTCGACGAGAAGCGACTGCCCAAT
>probe:Drosophila_2:1626278_at:408:409; Interrogation_Position=769; Antisense; GACGCGGTGGCTTCAAAATCGCCGA
>probe:Drosophila_2:1626278_at:598:93; Interrogation_Position=793; Antisense; AGTTCGCCAAGAAGTACGCCCTCGG
>probe:Drosophila_2:1626278_at:635:483; Interrogation_Position=832; Antisense; GTAACCTCTACCAGGCTGAGTACGA
>probe:Drosophila_2:1626278_at:695:113; Interrogation_Position=880; Antisense; AGCAGCTGGGCGCTTAGTTTCTACG
>probe:Drosophila_2:1626278_at:707:51; Interrogation_Position=978; Antisense; ATGAACACTCTGTGAAACCCTCTGT
>probe:Drosophila_2:1626278_at:282:613; Interrogation_Position=990; Antisense; TGAAACCCTCTGTTGCTGGCAATAA

Paste this into a BLAST search page for me
TATTGTCGTGAAGCCGGGTCAGGTCGAGGCGGACGCCAATAAGCTGTACAAATAAGCTGTACACCCTCTGCATGAACATACCCGGTGGAGATGTCGCCAAGGACTCCATCGTTACGTTTTCCTGATACGTTTTCCTGATCTACGAGCAGCAGCGGTGCAAGCTCACATTCGACGAATTCGACGAGAAGCGACTGCCCAATGACGCGGTGGCTTCAAAATCGCCGAAGTTCGCCAAGAAGTACGCCCTCGGGTAACCTCTACCAGGCTGAGTACGAAGCAGCTGGGCGCTTAGTTTCTACGATGAACACTCTGTGAAACCCTCTGTTGAAACCCTCTGTTGCTGGCAATAA

Full Affymetrix probeset data:

Annotations for 1626278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720