FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626279_at:

>probe:Drosophila_2:1626279_at:503:353; Interrogation_Position=224; Antisense; GCAGCGAGTGCGGTGAGTATTCAAT
>probe:Drosophila_2:1626279_at:446:121; Interrogation_Position=226; Antisense; AGCGAGTGCGGTGAGTATTCAATAT
>probe:Drosophila_2:1626279_at:115:331; Interrogation_Position=233; Antisense; GCGGTGAGTATTCAATATGTTCCTC
>probe:Drosophila_2:1626279_at:432:511; Interrogation_Position=236; Antisense; GTGAGTATTCAATATGTTCCTCGAT
>probe:Drosophila_2:1626279_at:397:89; Interrogation_Position=239; Antisense; AGTATTCAATATGTTCCTCGATCGG
>probe:Drosophila_2:1626279_at:658:479; Interrogation_Position=240; Antisense; GTATTCAATATGTTCCTCGATCGGT
>probe:Drosophila_2:1626279_at:563:13; Interrogation_Position=242; Antisense; ATTCAATATGTTCCTCGATCGGTGT
>probe:Drosophila_2:1626279_at:260:653; Interrogation_Position=244; Antisense; TCAATATGTTCCTCGATCGGTGTAA
>probe:Drosophila_2:1626279_at:121:243; Interrogation_Position=246; Antisense; AATATGTTCCTCGATCGGTGTAAGC
>probe:Drosophila_2:1626279_at:426:679; Interrogation_Position=248; Antisense; TATGTTCCTCGATCGGTGTAAGCCC
>probe:Drosophila_2:1626279_at:79:53; Interrogation_Position=249; Antisense; ATGTTCCTCGATCGGTGTAAGCCCC
>probe:Drosophila_2:1626279_at:124:293; Interrogation_Position=257; Antisense; CGATCGGTGTAAGCCCCCCATATGG
>probe:Drosophila_2:1626279_at:165:25; Interrogation_Position=276; Antisense; ATATGGGCTGTCAACCTCCGCTGGG
>probe:Drosophila_2:1626279_at:2:653; Interrogation_Position=286; Antisense; TCAACCTCCGCTGGGGACATTAGCA

Paste this into a BLAST search page for me
GCAGCGAGTGCGGTGAGTATTCAATAGCGAGTGCGGTGAGTATTCAATATGCGGTGAGTATTCAATATGTTCCTCGTGAGTATTCAATATGTTCCTCGATAGTATTCAATATGTTCCTCGATCGGGTATTCAATATGTTCCTCGATCGGTATTCAATATGTTCCTCGATCGGTGTTCAATATGTTCCTCGATCGGTGTAAAATATGTTCCTCGATCGGTGTAAGCTATGTTCCTCGATCGGTGTAAGCCCATGTTCCTCGATCGGTGTAAGCCCCCGATCGGTGTAAGCCCCCCATATGGATATGGGCTGTCAACCTCCGCTGGGTCAACCTCCGCTGGGGACATTAGCA

Full Affymetrix probeset data:

Annotations for 1626279_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720