Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626280_a_at:

>probe:Drosophila_2:1626280_a_at:75:417; Interrogation_Position=113; Antisense; GAGCGCATCGAGGATCTTAACCTGC
>probe:Drosophila_2:1626280_a_at:120:709; Interrogation_Position=129; Antisense; TTAACCTGCCGAATGCCGTGATTGG
>probe:Drosophila_2:1626280_a_at:129:121; Interrogation_Position=13; Antisense; AGCTGTTTACTCTTTACGCGGGAAG
>probe:Drosophila_2:1626280_a_at:78:729; Interrogation_Position=150; Antisense; TTGGCCGGCTCATCAAGGAAGCACT
>probe:Drosophila_2:1626280_a_at:320:145; Interrogation_Position=172; Antisense; ACTGCCGGAGTCAGCTAGTGTCAGC
>probe:Drosophila_2:1626280_a_at:682:39; Interrogation_Position=229; Antisense; ATCTGTGTTTGCCATCTTCGTGACA
>probe:Drosophila_2:1626280_a_at:79:467; Interrogation_Position=268; Antisense; GTTGGCCCACAAGCAGAACCACAAG
>probe:Drosophila_2:1626280_a_at:10:381; Interrogation_Position=283; Antisense; GAACCACAAGACCATCACGGCCAAG
>probe:Drosophila_2:1626280_a_at:712:223; Interrogation_Position=305; Antisense; AAGGATATTCTACAGACCCTCACCG
>probe:Drosophila_2:1626280_a_at:487:675; Interrogation_Position=333; Antisense; TAGACTTCGAAAGCTTCGTGCCCTC
>probe:Drosophila_2:1626280_a_at:557:641; Interrogation_Position=358; Antisense; TCTGACGCAGGATCTCGAGGTCTAT
>probe:Drosophila_2:1626280_a_at:598:371; Interrogation_Position=424; Antisense; GAAGGATTCCAACACTGCCGAAAAT
>probe:Drosophila_2:1626280_a_at:445:625; Interrogation_Position=439; Antisense; TGCCGAAAATGCCAACGCCAGTGCC
>probe:Drosophila_2:1626280_a_at:569:543; Interrogation_Position=516; Antisense; GGATCAATTATCCTCTTCAGTCATT

Paste this into a BLAST search page for me
GAGCGCATCGAGGATCTTAACCTGCTTAACCTGCCGAATGCCGTGATTGGAGCTGTTTACTCTTTACGCGGGAAGTTGGCCGGCTCATCAAGGAAGCACTACTGCCGGAGTCAGCTAGTGTCAGCATCTGTGTTTGCCATCTTCGTGACAGTTGGCCCACAAGCAGAACCACAAGGAACCACAAGACCATCACGGCCAAGAAGGATATTCTACAGACCCTCACCGTAGACTTCGAAAGCTTCGTGCCCTCTCTGACGCAGGATCTCGAGGTCTATGAAGGATTCCAACACTGCCGAAAATTGCCGAAAATGCCAACGCCAGTGCCGGATCAATTATCCTCTTCAGTCATT

Full Affymetrix probeset data:

Annotations for 1626280_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime