FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626285_at:

>probe:Drosophila_2:1626285_at:383:345; Interrogation_Position=1022; Antisense; GCATTCCTGCACTTTATTTATTCCT
>probe:Drosophila_2:1626285_at:693:159; Interrogation_Position=1070; Antisense; ACAACTCATGTTTACCCTGGAATAA
>probe:Drosophila_2:1626285_at:664:29; Interrogation_Position=1150; Antisense; ATAAAGATTCAACCACCATGTCCGT
>probe:Drosophila_2:1626285_at:566:45; Interrogation_Position=650; Antisense; ATCCCAATATCTTCTACGTGTGCAA
>probe:Drosophila_2:1626285_at:536:515; Interrogation_Position=667; Antisense; GTGTGCAAGTCGACGGTTAACCAGA
>probe:Drosophila_2:1626285_at:233:439; Interrogation_Position=739; Antisense; GATGGCGAGACCTTCGTGGACTACG
>probe:Drosophila_2:1626285_at:110:521; Interrogation_Position=754; Antisense; GTGGACTACGTCTGCCGCAGCGGAT
>probe:Drosophila_2:1626285_at:730:531; Interrogation_Position=813; Antisense; GGTGATCATCGAGGATCCCAACGAC
>probe:Drosophila_2:1626285_at:565:407; Interrogation_Position=835; Antisense; GACGACGACTTTTCGGTGCTGCCCA
>probe:Drosophila_2:1626285_at:677:185; Interrogation_Position=859; Antisense; AACACCTGTCAGCACGTGGGCTTGA
>probe:Drosophila_2:1626285_at:666:435; Interrogation_Position=889; Antisense; GATGGAAACGACTGCCGGAAGTACT
>probe:Drosophila_2:1626285_at:15:375; Interrogation_Position=906; Antisense; GAAGTACTACTACTGCTCGGCTCTA
>probe:Drosophila_2:1626285_at:246:665; Interrogation_Position=929; Antisense; TAAATGGCACCCTGCGGCACATGGA
>probe:Drosophila_2:1626285_at:594:249; Interrogation_Position=960; Antisense; CAATGGGACTTACTACCGACCGGAG

Paste this into a BLAST search page for me
GCATTCCTGCACTTTATTTATTCCTACAACTCATGTTTACCCTGGAATAAATAAAGATTCAACCACCATGTCCGTATCCCAATATCTTCTACGTGTGCAAGTGTGCAAGTCGACGGTTAACCAGAGATGGCGAGACCTTCGTGGACTACGGTGGACTACGTCTGCCGCAGCGGATGGTGATCATCGAGGATCCCAACGACGACGACGACTTTTCGGTGCTGCCCAAACACCTGTCAGCACGTGGGCTTGAGATGGAAACGACTGCCGGAAGTACTGAAGTACTACTACTGCTCGGCTCTATAAATGGCACCCTGCGGCACATGGACAATGGGACTTACTACCGACCGGAG

Full Affymetrix probeset data:

Annotations for 1626285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720