FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626286_at:

>probe:Drosophila_2:1626286_at:118:435; Interrogation_Position=1009; Antisense; GAGGGCATGTCCTGCGACTTAAAGT
>probe:Drosophila_2:1626286_at:232:47; Interrogation_Position=1034; Antisense; ACCTACGAGGTCTGGGCATTTGCGA
>probe:Drosophila_2:1626286_at:489:429; Interrogation_Position=1099; Antisense; GAGTTACTGCCCACCAATATAAGCG
>probe:Drosophila_2:1626286_at:426:269; Interrogation_Position=1128; Antisense; CATGCGGGCGCTATTTAAGACTAAA
>probe:Drosophila_2:1626286_at:253:109; Interrogation_Position=596; Antisense; AGAAGCTACTCTTTACCTTTTCGCA
>probe:Drosophila_2:1626286_at:21:87; Interrogation_Position=638; Antisense; AGTGCAGCCGCGGTCAGTTCATGGA
>probe:Drosophila_2:1626286_at:354:455; Interrogation_Position=759; Antisense; GATAAGCGAAAACTCCTGGGCCTTG
>probe:Drosophila_2:1626286_at:181:529; Interrogation_Position=797; Antisense; GGGAGGAGACCATCAATGCACTGAA
>probe:Drosophila_2:1626286_at:296:521; Interrogation_Position=844; Antisense; GTGGCTGGGCTGTTTGATATCTATA
>probe:Drosophila_2:1626286_at:600:457; Interrogation_Position=859; Antisense; GATATCTATACCATTCCCAGTGAAC
>probe:Drosophila_2:1626286_at:119:469; Interrogation_Position=884; Antisense; GTTGCCCGGGCAAGTTTGAGTACCA
>probe:Drosophila_2:1626286_at:585:591; Interrogation_Position=917; Antisense; TGGTCTCCCGCATTGTGGCACAGAA
>probe:Drosophila_2:1626286_at:490:155; Interrogation_Position=936; Antisense; ACAGAACATTCTTCAGCCGGGTTTG
>probe:Drosophila_2:1626286_at:132:199; Interrogation_Position=970; Antisense; AACGAGGAGTTCATGCGCACCTGGC

Paste this into a BLAST search page for me
GAGGGCATGTCCTGCGACTTAAAGTACCTACGAGGTCTGGGCATTTGCGAGAGTTACTGCCCACCAATATAAGCGCATGCGGGCGCTATTTAAGACTAAAAGAAGCTACTCTTTACCTTTTCGCAAGTGCAGCCGCGGTCAGTTCATGGAGATAAGCGAAAACTCCTGGGCCTTGGGGAGGAGACCATCAATGCACTGAAGTGGCTGGGCTGTTTGATATCTATAGATATCTATACCATTCCCAGTGAACGTTGCCCGGGCAAGTTTGAGTACCATGGTCTCCCGCATTGTGGCACAGAAACAGAACATTCTTCAGCCGGGTTTGAACGAGGAGTTCATGCGCACCTGGC

Full Affymetrix probeset data:

Annotations for 1626286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720