FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626287_at:

>probe:Drosophila_2:1626287_at:549:105; Interrogation_Position=1007; Antisense; AGACAGCAACACAACTGCCGCATCG
>probe:Drosophila_2:1626287_at:140:411; Interrogation_Position=1031; Antisense; GACGACAACATCTACGAGCACGCAG
>probe:Drosophila_2:1626287_at:545:357; Interrogation_Position=1086; Antisense; GCACACGAGAAGAGCGCCCATCTGA
>probe:Drosophila_2:1626287_at:465:159; Interrogation_Position=1120; Antisense; ACAAGCAGAAGAAGCTCCTCCAGCT
>probe:Drosophila_2:1626287_at:462:629; Interrogation_Position=1135; Antisense; TCCTCCAGCTGCACATGGAGCAGGA
>probe:Drosophila_2:1626287_at:157:179; Interrogation_Position=1193; Antisense; AAACTCGTTGCAGACCAGTTGAGCG
>probe:Drosophila_2:1626287_at:435:327; Interrogation_Position=1221; Antisense; GCGATCGACGGCTAGCAGCTGAAAA
>probe:Drosophila_2:1626287_at:535:149; Interrogation_Position=1266; Antisense; ACATTACCTTTAAGACTTGCCCACA
>probe:Drosophila_2:1626287_at:470:657; Interrogation_Position=1276; Antisense; TAAGACTTGCCCACAATGTTGTAAA
>probe:Drosophila_2:1626287_at:317:697; Interrogation_Position=748; Antisense; TTTCACAATCATCTTGCTCCATCCA
>probe:Drosophila_2:1626287_at:179:13; Interrogation_Position=792; Antisense; ATTCATGTCCATGTCATAATCGCAT
>probe:Drosophila_2:1626287_at:511:497; Interrogation_Position=804; Antisense; GTCATAATCGCATGCATCATCTCGT
>probe:Drosophila_2:1626287_at:3:619; Interrogation_Position=816; Antisense; TGCATCATCTCGTTGCAGTTGCAGC
>probe:Drosophila_2:1626287_at:489:115; Interrogation_Position=904; Antisense; AGCAGTCGCGGTCTCAGGCTCTCAG

Paste this into a BLAST search page for me
AGACAGCAACACAACTGCCGCATCGGACGACAACATCTACGAGCACGCAGGCACACGAGAAGAGCGCCCATCTGAACAAGCAGAAGAAGCTCCTCCAGCTTCCTCCAGCTGCACATGGAGCAGGAAAACTCGTTGCAGACCAGTTGAGCGGCGATCGACGGCTAGCAGCTGAAAAACATTACCTTTAAGACTTGCCCACATAAGACTTGCCCACAATGTTGTAAATTTCACAATCATCTTGCTCCATCCAATTCATGTCCATGTCATAATCGCATGTCATAATCGCATGCATCATCTCGTTGCATCATCTCGTTGCAGTTGCAGCAGCAGTCGCGGTCTCAGGCTCTCAG

Full Affymetrix probeset data:

Annotations for 1626287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720