FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626289_at:

>probe:Drosophila_2:1626289_at:74:389; Interrogation_Position=1439; Antisense; GAAAAGCTGACCTTGTATCTGGACA
>probe:Drosophila_2:1626289_at:157:187; Interrogation_Position=1463; Antisense; AACAAGCCAGTGCAACTGCCTGAGC
>probe:Drosophila_2:1626289_at:93:577; Interrogation_Position=1492; Antisense; GGCGCTGGTGTTCCTAAATATCGAC
>probe:Drosophila_2:1626289_at:206:121; Interrogation_Position=1525; Antisense; AGCTGGCTGCAAGCTCTGCGAGCTA
>probe:Drosophila_2:1626289_at:281:345; Interrogation_Position=1572; Antisense; GCATTGTAAACTCCATCTCCGATGG
>probe:Drosophila_2:1626289_at:377:81; Interrogation_Position=1605; Antisense; AGGTGTTCGGCATTGTTTCCTCTTT
>probe:Drosophila_2:1626289_at:558:175; Interrogation_Position=1661; Antisense; AAACCAGTGCGAATTGGCCAAGCCA
>probe:Drosophila_2:1626289_at:712:493; Interrogation_Position=1703; Antisense; GTCAAGGAGACCGTGCCAATGCAGG
>probe:Drosophila_2:1626289_at:415:69; Interrogation_Position=1731; Antisense; ATGGCGAACCCTGGATGCAGAGTCC
>probe:Drosophila_2:1626289_at:258:101; Interrogation_Position=1749; Antisense; AGAGTCCAGCGGATATTCGCCTCTC
>probe:Drosophila_2:1626289_at:105:121; Interrogation_Position=1800; Antisense; AGCTGGCTGCAACCTGAACATTAAT
>probe:Drosophila_2:1626289_at:87:243; Interrogation_Position=1836; Antisense; AATAGAATCCCTTATGTGCCAGTCC
>probe:Drosophila_2:1626289_at:278:597; Interrogation_Position=1850; Antisense; TGTGCCAGTCCCTAATCTCAAAGTA
>probe:Drosophila_2:1626289_at:375:489; Interrogation_Position=1872; Antisense; GTACTTAACCTGGAACCTCAATGTA

Paste this into a BLAST search page for me
GAAAAGCTGACCTTGTATCTGGACAAACAAGCCAGTGCAACTGCCTGAGCGGCGCTGGTGTTCCTAAATATCGACAGCTGGCTGCAAGCTCTGCGAGCTAGCATTGTAAACTCCATCTCCGATGGAGGTGTTCGGCATTGTTTCCTCTTTAAACCAGTGCGAATTGGCCAAGCCAGTCAAGGAGACCGTGCCAATGCAGGATGGCGAACCCTGGATGCAGAGTCCAGAGTCCAGCGGATATTCGCCTCTCAGCTGGCTGCAACCTGAACATTAATAATAGAATCCCTTATGTGCCAGTCCTGTGCCAGTCCCTAATCTCAAAGTAGTACTTAACCTGGAACCTCAATGTA

Full Affymetrix probeset data:

Annotations for 1626289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720