Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626290_at:

>probe:Drosophila_2:1626290_at:110:595; Interrogation_Position=4352; Antisense; TGTGATATGCCGAAAGTGCAATGAA
>probe:Drosophila_2:1626290_at:428:245; Interrogation_Position=4445; Antisense; AATTTTGCCAGTTTTATTTGCCATG
>probe:Drosophila_2:1626290_at:81:315; Interrogation_Position=4451; Antisense; GCCAGTTTTATTTGCCATGCTTTTA
>probe:Drosophila_2:1626290_at:653:341; Interrogation_Position=4469; Antisense; GCTTTTATATTATTTTTCGCCATTA
>probe:Drosophila_2:1626290_at:213:257; Interrogation_Position=4574; Antisense; CAAATGTCAACCTAAGATCTCTTAA
>probe:Drosophila_2:1626290_at:661:201; Interrogation_Position=4619; Antisense; AAGCCATTTAGTGTCTTTGGAATAT
>probe:Drosophila_2:1626290_at:169:705; Interrogation_Position=4658; Antisense; TTAGTTATAACACTTCAACATTGCT
>probe:Drosophila_2:1626290_at:325:189; Interrogation_Position=4674; Antisense; AACATTGCTATATTGCGCAGCTATT
>probe:Drosophila_2:1626290_at:205:17; Interrogation_Position=4710; Antisense; ATTTTTCATGTATACACTCAGTTGG
>probe:Drosophila_2:1626290_at:302:29; Interrogation_Position=4721; Antisense; ATACACTCAGTTGGTTATTACACAG
>probe:Drosophila_2:1626290_at:366:385; Interrogation_Position=4790; Antisense; GAAAATAGCTCCGATTTTCTTTGAA
>probe:Drosophila_2:1626290_at:480:19; Interrogation_Position=4837; Antisense; ATCTACTTAACCATTCAACTACTAC
>probe:Drosophila_2:1626290_at:422:517; Interrogation_Position=4911; Antisense; GTGTGAGCAATTTCTGCCTCAGGTG
>probe:Drosophila_2:1626290_at:126:715; Interrogation_Position=4922; Antisense; TTCTGCCTCAGGTGGTTTCATGAAA

Paste this into a BLAST search page for me
TGTGATATGCCGAAAGTGCAATGAAAATTTTGCCAGTTTTATTTGCCATGGCCAGTTTTATTTGCCATGCTTTTAGCTTTTATATTATTTTTCGCCATTACAAATGTCAACCTAAGATCTCTTAAAAGCCATTTAGTGTCTTTGGAATATTTAGTTATAACACTTCAACATTGCTAACATTGCTATATTGCGCAGCTATTATTTTTCATGTATACACTCAGTTGGATACACTCAGTTGGTTATTACACAGGAAAATAGCTCCGATTTTCTTTGAAATCTACTTAACCATTCAACTACTACGTGTGAGCAATTTCTGCCTCAGGTGTTCTGCCTCAGGTGGTTTCATGAAA

Full Affymetrix probeset data:

Annotations for 1626290_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime