FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626291_at:

>probe:Drosophila_2:1626291_at:345:205; Interrogation_Position=1057; Antisense; AAGCGCCTTCATTTTGTGTTAGTCT
>probe:Drosophila_2:1626291_at:657:413; Interrogation_Position=1118; Antisense; GACCATTACGCATTCATACATACAT
>probe:Drosophila_2:1626291_at:11:251; Interrogation_Position=707; Antisense; CAATGGCAATGGTCGCAACGGTGGC
>probe:Drosophila_2:1626291_at:186:703; Interrogation_Position=734; Antisense; TTATGATAGCAACGCGCAGCAGGGC
>probe:Drosophila_2:1626291_at:193:345; Interrogation_Position=752; Antisense; GCAGGGCAAATTCAACGGCTACTAA
>probe:Drosophila_2:1626291_at:657:525; Interrogation_Position=787; Antisense; TGAGGATACCCGATTTAGGTCGACC
>probe:Drosophila_2:1626291_at:630:27; Interrogation_Position=820; Antisense; ATACTCGTCTACTTCATGGGATCGC
>probe:Drosophila_2:1626291_at:531:447; Interrogation_Position=839; Antisense; GATCGCTGGCCGAGTATTAAACGCA
>probe:Drosophila_2:1626291_at:647:13; Interrogation_Position=854; Antisense; ATTAAACGCACATCCAGCCAGTGGG
>probe:Drosophila_2:1626291_at:711:293; Interrogation_Position=883; Antisense; CGATCGCAGTCAGTCTATCCATATA
>probe:Drosophila_2:1626291_at:265:23; Interrogation_Position=903; Antisense; ATATAACCCTATTCCCATCTCTGTG
>probe:Drosophila_2:1626291_at:321:37; Interrogation_Position=919; Antisense; ATCTCTGTGCATACCCTTAGTGGGA
>probe:Drosophila_2:1626291_at:694:15; Interrogation_Position=952; Antisense; ATTTTGCCATAGACAGGCGCGTTCC
>probe:Drosophila_2:1626291_at:18:713; Interrogation_Position=990; Antisense; TTCACTGCTGTTCGTTATCCTGTTT

Paste this into a BLAST search page for me
AAGCGCCTTCATTTTGTGTTAGTCTGACCATTACGCATTCATACATACATCAATGGCAATGGTCGCAACGGTGGCTTATGATAGCAACGCGCAGCAGGGCGCAGGGCAAATTCAACGGCTACTAATGAGGATACCCGATTTAGGTCGACCATACTCGTCTACTTCATGGGATCGCGATCGCTGGCCGAGTATTAAACGCAATTAAACGCACATCCAGCCAGTGGGCGATCGCAGTCAGTCTATCCATATAATATAACCCTATTCCCATCTCTGTGATCTCTGTGCATACCCTTAGTGGGAATTTTGCCATAGACAGGCGCGTTCCTTCACTGCTGTTCGTTATCCTGTTT

Full Affymetrix probeset data:

Annotations for 1626291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720