FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626292_at:

>probe:Drosophila_2:1626292_at:595:413; Interrogation_Position=1456; Antisense; GACCAATAACTCTTTCCTCTGGAAG
>probe:Drosophila_2:1626292_at:403:363; Interrogation_Position=1480; Antisense; GAATTTCCAAAAGGCCGGAGCTCTC
>probe:Drosophila_2:1626292_at:199:577; Interrogation_Position=1521; Antisense; GGCGCATGCCCCTATGGAGGTACTT
>probe:Drosophila_2:1626292_at:639:339; Interrogation_Position=1537; Antisense; GAGGTACTTCCGCAAATTAGTGGCC
>probe:Drosophila_2:1626292_at:184:573; Interrogation_Position=1621; Antisense; GGCTGCTATCCTTTACGAACTGGTT
>probe:Drosophila_2:1626292_at:581:141; Interrogation_Position=1677; Antisense; ACGGCACCGGAATGCTGGCTAAGCA
>probe:Drosophila_2:1626292_at:298:427; Interrogation_Position=1704; Antisense; GAGTTCCTCCGTATTTGCTCAAGGA
>probe:Drosophila_2:1626292_at:273:79; Interrogation_Position=1725; Antisense; AGGATTGCATGACTGGTCGTCCGAC
>probe:Drosophila_2:1626292_at:425:93; Interrogation_Position=1764; Antisense; AGTTCCTCTACCAGATGGCCTGCAA
>probe:Drosophila_2:1626292_at:84:669; Interrogation_Position=1808; Antisense; TACTTGACGAGGGATCCGCGACATC
>probe:Drosophila_2:1626292_at:312:271; Interrogation_Position=1829; Antisense; CATCCCGATAATACGTGTCTGTGTG
>probe:Drosophila_2:1626292_at:264:267; Interrogation_Position=1860; Antisense; CAGTGTCCTTTATGTGCTCGGTCAC
>probe:Drosophila_2:1626292_at:499:507; Interrogation_Position=1873; Antisense; GTGCTCGGTCACTTGTTCTATATTA
>probe:Drosophila_2:1626292_at:436:15; Interrogation_Position=1894; Antisense; ATTATCCATTTGACGTGCCCATGTT

Paste this into a BLAST search page for me
GACCAATAACTCTTTCCTCTGGAAGGAATTTCCAAAAGGCCGGAGCTCTCGGCGCATGCCCCTATGGAGGTACTTGAGGTACTTCCGCAAATTAGTGGCCGGCTGCTATCCTTTACGAACTGGTTACGGCACCGGAATGCTGGCTAAGCAGAGTTCCTCCGTATTTGCTCAAGGAAGGATTGCATGACTGGTCGTCCGACAGTTCCTCTACCAGATGGCCTGCAATACTTGACGAGGGATCCGCGACATCCATCCCGATAATACGTGTCTGTGTGCAGTGTCCTTTATGTGCTCGGTCACGTGCTCGGTCACTTGTTCTATATTAATTATCCATTTGACGTGCCCATGTT

Full Affymetrix probeset data:

Annotations for 1626292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720