FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626296_at:

>probe:Drosophila_2:1626296_at:66:193; Interrogation_Position=104; Antisense; AACTTTGATTTGTGCCACGCTCCAA
>probe:Drosophila_2:1626296_at:18:229; Interrogation_Position=144; Antisense; AAGGCCAGCCGCAAGTACGAGGACG
>probe:Drosophila_2:1626296_at:235:189; Interrogation_Position=217; Antisense; AACAGGCGCTTATCCATGGCCGCAA
>probe:Drosophila_2:1626296_at:506:189; Interrogation_Position=240; Antisense; AACTCCATTTCCACGGCGGCAGGTT
>probe:Drosophila_2:1626296_at:124:569; Interrogation_Position=257; Antisense; GGCAGGTTCCACCACGGACATGCAG
>probe:Drosophila_2:1626296_at:166:557; Interrogation_Position=272; Antisense; GGACATGCAGCATCGCCAGCGGAAA
>probe:Drosophila_2:1626296_at:312:561; Interrogation_Position=292; Antisense; GGAAACAGCGCAATCATCTCAATAA
>probe:Drosophila_2:1626296_at:627:409; Interrogation_Position=360; Antisense; GACGACGACCGGGATCAGCACGAAT
>probe:Drosophila_2:1626296_at:463:263; Interrogation_Position=375; Antisense; CAGCACGAATCGGAGGTGTTCCTCA
>probe:Drosophila_2:1626296_at:708:577; Interrogation_Position=408; Antisense; GGCCGCATTGTCGAGCAGCTCAAGT
>probe:Drosophila_2:1626296_at:507:115; Interrogation_Position=424; Antisense; AGCTCAAGTTAAAGACCTTCCCCAG
>probe:Drosophila_2:1626296_at:150:55; Interrogation_Position=609; Antisense; ATGCACAGTCTCAATGGCAGCCTAA
>probe:Drosophila_2:1626296_at:153:233; Interrogation_Position=640; Antisense; AATCCGGACCGGTGAATGGCGCTCT
>probe:Drosophila_2:1626296_at:652:227; Interrogation_Position=654; Antisense; AATGGCGCTCTCAAAGCACGGGTTA

Paste this into a BLAST search page for me
AACTTTGATTTGTGCCACGCTCCAAAAGGCCAGCCGCAAGTACGAGGACGAACAGGCGCTTATCCATGGCCGCAAAACTCCATTTCCACGGCGGCAGGTTGGCAGGTTCCACCACGGACATGCAGGGACATGCAGCATCGCCAGCGGAAAGGAAACAGCGCAATCATCTCAATAAGACGACGACCGGGATCAGCACGAATCAGCACGAATCGGAGGTGTTCCTCAGGCCGCATTGTCGAGCAGCTCAAGTAGCTCAAGTTAAAGACCTTCCCCAGATGCACAGTCTCAATGGCAGCCTAAAATCCGGACCGGTGAATGGCGCTCTAATGGCGCTCTCAAAGCACGGGTTA

Full Affymetrix probeset data:

Annotations for 1626296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720