FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626298_at:

>probe:Drosophila_2:1626298_at:128:347; Interrogation_Position=107; Antisense; GCATCAACCAGACCGCATACAATTT
>probe:Drosophila_2:1626298_at:130:31; Interrogation_Position=123; Antisense; ATACAATTTGTGCTTCGGCTCCACT
>probe:Drosophila_2:1626298_at:200:363; Interrogation_Position=153; Antisense; GAATACCAACCAAACCTTCGTCTGC
>probe:Drosophila_2:1626298_at:484:717; Interrogation_Position=169; Antisense; TTCGTCTGCACGGATGGCCTGGTGT
>probe:Drosophila_2:1626298_at:84:415; Interrogation_Position=199; Antisense; GACCAGCCAGTGATCTGTTTCCAGA
>probe:Drosophila_2:1626298_at:464:243; Interrogation_Position=20; Antisense; AATTACTCGGTTTGATTGCCTTGGT
>probe:Drosophila_2:1626298_at:661:93; Interrogation_Position=241; Antisense; AGTTGCGGCGACACTGATAGCTGTG
>probe:Drosophila_2:1626298_at:424:27; Interrogation_Position=257; Antisense; ATAGCTGTGGCCAGTGTGCTCCCAA
>probe:Drosophila_2:1626298_at:32:721; Interrogation_Position=360; Antisense; TTGCCCGGATGGTTACTTCTGTGAC
>probe:Drosophila_2:1626298_at:89:269; Interrogation_Position=394; Antisense; CAGGAGATCTGCGTCACCAAGGCCA
>probe:Drosophila_2:1626298_at:522:727; Interrogation_Position=40; Antisense; TTGGTGGCCTTTCCAATCGCTTGGA
>probe:Drosophila_2:1626298_at:292:611; Interrogation_Position=423; Antisense; TGACTCCATCATCTGCCACTTGAAT
>probe:Drosophila_2:1626298_at:218:45; Interrogation_Position=55; Antisense; ATCGCTTGGATCCAGGCAGACTGTA
>probe:Drosophila_2:1626298_at:453:683; Interrogation_Position=83; Antisense; TATGCCAGTCAAATGGAGCCTCCTG

Paste this into a BLAST search page for me
GCATCAACCAGACCGCATACAATTTATACAATTTGTGCTTCGGCTCCACTGAATACCAACCAAACCTTCGTCTGCTTCGTCTGCACGGATGGCCTGGTGTGACCAGCCAGTGATCTGTTTCCAGAAATTACTCGGTTTGATTGCCTTGGTAGTTGCGGCGACACTGATAGCTGTGATAGCTGTGGCCAGTGTGCTCCCAATTGCCCGGATGGTTACTTCTGTGACCAGGAGATCTGCGTCACCAAGGCCATTGGTGGCCTTTCCAATCGCTTGGATGACTCCATCATCTGCCACTTGAATATCGCTTGGATCCAGGCAGACTGTATATGCCAGTCAAATGGAGCCTCCTG

Full Affymetrix probeset data:

Annotations for 1626298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720