FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626299_at:

>probe:Drosophila_2:1626299_at:412:125; Interrogation_Position=5783; Antisense; AGCCGCGGCAGCAACGACACATTCA
>probe:Drosophila_2:1626299_at:689:715; Interrogation_Position=5831; Antisense; TTCGCGGCTCAGCAGTTTAGTGTGC
>probe:Drosophila_2:1626299_at:624:697; Interrogation_Position=5846; Antisense; TTTAGTGTGCCGAATGCGCTCCAGC
>probe:Drosophila_2:1626299_at:31:631; Interrogation_Position=5897; Antisense; TCCGGCGATCCGATGGCTCAGGAAT
>probe:Drosophila_2:1626299_at:435:73; Interrogation_Position=5916; Antisense; AGGAATTGCTTCTCGAGAGCCCCAG
>probe:Drosophila_2:1626299_at:715:415; Interrogation_Position=5932; Antisense; GAGCCCCAGCAGAGTGAGTAGCGAT
>probe:Drosophila_2:1626299_at:542:519; Interrogation_Position=5972; Antisense; GTGGAAGATATGTGACGATTGCCCC
>probe:Drosophila_2:1626299_at:408:707; Interrogation_Position=5998; Antisense; TTACTACTATCGTCTGCTCAACAGG
>probe:Drosophila_2:1626299_at:66:113; Interrogation_Position=6025; Antisense; AGCAAACTACATGCGCTGGACGGAG
>probe:Drosophila_2:1626299_at:682:557; Interrogation_Position=6102; Antisense; GGACATCCTGGTGGCTGACATGGAC
>probe:Drosophila_2:1626299_at:707:609; Interrogation_Position=6117; Antisense; TGACATGGACGACGATGCCGCCAAA
>probe:Drosophila_2:1626299_at:524:49; Interrogation_Position=6131; Antisense; ATGCCGCCAAATCAGCCGGACAGTT
>probe:Drosophila_2:1626299_at:525:323; Interrogation_Position=6181; Antisense; GCGAATGCACGATTTGTGTCGTAAA
>probe:Drosophila_2:1626299_at:663:15; Interrogation_Position=6234; Antisense; ATTATTGCTGCTGTTTGCTGTTTAT

Paste this into a BLAST search page for me
AGCCGCGGCAGCAACGACACATTCATTCGCGGCTCAGCAGTTTAGTGTGCTTTAGTGTGCCGAATGCGCTCCAGCTCCGGCGATCCGATGGCTCAGGAATAGGAATTGCTTCTCGAGAGCCCCAGGAGCCCCAGCAGAGTGAGTAGCGATGTGGAAGATATGTGACGATTGCCCCTTACTACTATCGTCTGCTCAACAGGAGCAAACTACATGCGCTGGACGGAGGGACATCCTGGTGGCTGACATGGACTGACATGGACGACGATGCCGCCAAAATGCCGCCAAATCAGCCGGACAGTTGCGAATGCACGATTTGTGTCGTAAAATTATTGCTGCTGTTTGCTGTTTAT

Full Affymetrix probeset data:

Annotations for 1626299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720