FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626301_at:

>probe:Drosophila_2:1626301_at:518:213; Interrogation_Position=1639; Antisense; AAGTTGTAAACTAAAATGCACCGCA
>probe:Drosophila_2:1626301_at:21:233; Interrogation_Position=1653; Antisense; AATGCACCGCAAATTAATTCGATGG
>probe:Drosophila_2:1626301_at:370:355; Interrogation_Position=1656; Antisense; GCACCGCAAATTAATTCGATGGGCT
>probe:Drosophila_2:1626301_at:359:245; Interrogation_Position=1664; Antisense; AATTAATTCGATGGGCTTGGTCCTC
>probe:Drosophila_2:1626301_at:339:247; Interrogation_Position=1668; Antisense; AATTCGATGGGCTTGGTCCTCAAAT
>probe:Drosophila_2:1626301_at:94:715; Interrogation_Position=1670; Antisense; TTCGATGGGCTTGGTCCTCAAATGG
>probe:Drosophila_2:1626301_at:678:293; Interrogation_Position=1672; Antisense; CGATGGGCTTGGTCCTCAAATGGGA
>probe:Drosophila_2:1626301_at:15:3; Interrogation_Position=1679; Antisense; CTTGGTCCTCAAATGGGAAGGGAGA
>probe:Drosophila_2:1626301_at:304:503; Interrogation_Position=1683; Antisense; GTCCTCAAATGGGAAGGGAGATGAA
>probe:Drosophila_2:1626301_at:397:223; Interrogation_Position=1706; Antisense; AAGGAAACTGATATGTAGTGAGAGA
>probe:Drosophila_2:1626301_at:292:1; Interrogation_Position=1731; Antisense; AAAGAGGTAGTGCTAAATGGAACTT
>probe:Drosophila_2:1626301_at:191:533; Interrogation_Position=1736; Antisense; GGTAGTGCTAAATGGAACTTAATTC
>probe:Drosophila_2:1626301_at:449:385; Interrogation_Position=1750; Antisense; GAACTTAATTCTATTCCACATATTA
>probe:Drosophila_2:1626301_at:507:11; Interrogation_Position=1757; Antisense; ATTCTATTCCACATATTATTCTATA

Paste this into a BLAST search page for me
AAGTTGTAAACTAAAATGCACCGCAAATGCACCGCAAATTAATTCGATGGGCACCGCAAATTAATTCGATGGGCTAATTAATTCGATGGGCTTGGTCCTCAATTCGATGGGCTTGGTCCTCAAATTTCGATGGGCTTGGTCCTCAAATGGCGATGGGCTTGGTCCTCAAATGGGACTTGGTCCTCAAATGGGAAGGGAGAGTCCTCAAATGGGAAGGGAGATGAAAAGGAAACTGATATGTAGTGAGAGAAAAGAGGTAGTGCTAAATGGAACTTGGTAGTGCTAAATGGAACTTAATTCGAACTTAATTCTATTCCACATATTAATTCTATTCCACATATTATTCTATA

Full Affymetrix probeset data:

Annotations for 1626301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720