FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626302_at:

>probe:Drosophila_2:1626302_at:137:659; Interrogation_Position=434; Antisense; TAACGGGATGCACGCGAACCGTTCG
>probe:Drosophila_2:1626302_at:462:621; Interrogation_Position=460; Antisense; TGCTGCGACCTTATGAACCACTGAT
>probe:Drosophila_2:1626302_at:670:3; Interrogation_Position=515; Antisense; ATTGGGCCTGGAGTTCCGGAGCAAC
>probe:Drosophila_2:1626302_at:324:425; Interrogation_Position=552; Antisense; GAGAGCGACAAGCACCAGAGGATTC
>probe:Drosophila_2:1626302_at:425:629; Interrogation_Position=588; Antisense; TCGCGGGAGACGGTCATGTCCAAGT
>probe:Drosophila_2:1626302_at:549:87; Interrogation_Position=619; Antisense; AGTCCATGGACAAGGCTCAGCTCGA
>probe:Drosophila_2:1626302_at:35:161; Interrogation_Position=650; Antisense; ACAACTGAAGAAGAGCCGACGCCCT
>probe:Drosophila_2:1626302_at:363:209; Interrogation_Position=731; Antisense; AAGCAGAGCAACTGTGGCGCCATTT
>probe:Drosophila_2:1626302_at:710:41; Interrogation_Position=773; Antisense; ATCGGTGCCCTGGTCACGCATATTA
>probe:Drosophila_2:1626302_at:128:537; Interrogation_Position=784; Antisense; GGTCACGCATATTAGCTTCCAAATC
>probe:Drosophila_2:1626302_at:185:165; Interrogation_Position=804; Antisense; AAATCAATTGCACGCATTTCCCTCT
>probe:Drosophila_2:1626302_at:122:673; Interrogation_Position=828; Antisense; TACGCGCTGCCAGTCTTAATAGCAT
>probe:Drosophila_2:1626302_at:615:673; Interrogation_Position=847; Antisense; TAGCATTTCTGTGTAGCTTCCGACC
>probe:Drosophila_2:1626302_at:410:75; Interrogation_Position=978; Antisense; AGGAGCCGCCTGTCTAGCCAATTAA

Paste this into a BLAST search page for me
TAACGGGATGCACGCGAACCGTTCGTGCTGCGACCTTATGAACCACTGATATTGGGCCTGGAGTTCCGGAGCAACGAGAGCGACAAGCACCAGAGGATTCTCGCGGGAGACGGTCATGTCCAAGTAGTCCATGGACAAGGCTCAGCTCGAACAACTGAAGAAGAGCCGACGCCCTAAGCAGAGCAACTGTGGCGCCATTTATCGGTGCCCTGGTCACGCATATTAGGTCACGCATATTAGCTTCCAAATCAAATCAATTGCACGCATTTCCCTCTTACGCGCTGCCAGTCTTAATAGCATTAGCATTTCTGTGTAGCTTCCGACCAGGAGCCGCCTGTCTAGCCAATTAA

Full Affymetrix probeset data:

Annotations for 1626302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720