Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626303_s_at:

>probe:Drosophila_2:1626303_s_at:689:117; Interrogation_Position=109; Antisense; ACGTATCAACAACCGCTTACAGTTC
>probe:Drosophila_2:1626303_s_at:218:275; Interrogation_Position=124; Antisense; CTTACAGTTCAACAGCCGGTTATCT
>probe:Drosophila_2:1626303_s_at:634:151; Interrogation_Position=135; Antisense; ACAGCCGGTTATCTTAGTTAAACAT
>probe:Drosophila_2:1626303_s_at:498:361; Interrogation_Position=183; Antisense; GAATTACCGGATTACATTACCGTCG
>probe:Drosophila_2:1626303_s_at:480:707; Interrogation_Position=199; Antisense; TTACCGTCGAAGGATCTCAAAGCAG
>probe:Drosophila_2:1626303_s_at:444:123; Interrogation_Position=227; Antisense; AGCCCTGTCTCACGATCACTTGGAA
>probe:Drosophila_2:1626303_s_at:30:455; Interrogation_Position=240; Antisense; GATCACTTGGAAGACCAATCCAGAT
>probe:Drosophila_2:1626303_s_at:332:235; Interrogation_Position=256; Antisense; AATCCAGATGGCACTGGTCCCGATG
>probe:Drosophila_2:1626303_s_at:45:535; Interrogation_Position=271; Antisense; GGTCCCGATGAACCACAAATCTACA
>probe:Drosophila_2:1626303_s_at:76:15; Interrogation_Position=289; Antisense; ATCTACATGGGTGATGGCTACTTCA
>probe:Drosophila_2:1626303_s_at:689:511; Interrogation_Position=299; Antisense; GTGATGGCTACTTCAGAATATTGCA
>probe:Drosophila_2:1626303_s_at:87:365; Interrogation_Position=314; Antisense; GAATATTGCAAGTAGCCCGAGGACA
>probe:Drosophila_2:1626303_s_at:252:487; Interrogation_Position=325; Antisense; GTAGCCCGAGGACAGAACAGCCAAT
>probe:Drosophila_2:1626303_s_at:719:367; Interrogation_Position=87; Antisense; GAATCCATCTCAACAACAAGCAACG

Paste this into a BLAST search page for me
ACGTATCAACAACCGCTTACAGTTCCTTACAGTTCAACAGCCGGTTATCTACAGCCGGTTATCTTAGTTAAACATGAATTACCGGATTACATTACCGTCGTTACCGTCGAAGGATCTCAAAGCAGAGCCCTGTCTCACGATCACTTGGAAGATCACTTGGAAGACCAATCCAGATAATCCAGATGGCACTGGTCCCGATGGGTCCCGATGAACCACAAATCTACAATCTACATGGGTGATGGCTACTTCAGTGATGGCTACTTCAGAATATTGCAGAATATTGCAAGTAGCCCGAGGACAGTAGCCCGAGGACAGAACAGCCAATGAATCCATCTCAACAACAAGCAACG

Full Affymetrix probeset data:

Annotations for 1626303_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime