FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626304_at:

>probe:Drosophila_2:1626304_at:690:511; Interrogation_Position=284; Antisense; GTGAGCGTGACGTCGAACCTGTCGT
>probe:Drosophila_2:1626304_at:149:419; Interrogation_Position=323; Antisense; GAGCAGCTGCGCAAGACCGGCAAGA
>probe:Drosophila_2:1626304_at:453:409; Interrogation_Position=377; Antisense; GACGAGTTCCTCAGCAAGTTTCAGA
>probe:Drosophila_2:1626304_at:297:141; Interrogation_Position=405; Antisense; ACGGCAGGCTGAAACTTGAGGTATA
>probe:Drosophila_2:1626304_at:713:3; Interrogation_Position=448; Antisense; ATTGAAATATCTTCCACGTTGCCGC
>probe:Drosophila_2:1626304_at:712:469; Interrogation_Position=465; Antisense; GTTGCCGCTCCGAAAGCATTCGATT
>probe:Drosophila_2:1626304_at:136:117; Interrogation_Position=479; Antisense; AGCATTCGATTTGGGTCGCTGTTCA
>probe:Drosophila_2:1626304_at:365:699; Interrogation_Position=571; Antisense; TTTACCTTAGTATTTGCTCTTGCCC
>probe:Drosophila_2:1626304_at:238:723; Interrogation_Position=584; Antisense; TTGCTCTTGCCCAAATTGTATGTAG
>probe:Drosophila_2:1626304_at:287:485; Interrogation_Position=601; Antisense; GTATGTAGCTCGTAGTTAACCAATT
>probe:Drosophila_2:1626304_at:309:43; Interrogation_Position=695; Antisense; ATCGTACAGCCAACTTTTTGCCTAA
>probe:Drosophila_2:1626304_at:125:721; Interrogation_Position=712; Antisense; TTGCCTAAGTATGCAGGTGCCGTAT
>probe:Drosophila_2:1626304_at:354:231; Interrogation_Position=775; Antisense; AATGATATACGCCAGTTGCCCTCTT
>probe:Drosophila_2:1626304_at:152:469; Interrogation_Position=789; Antisense; GTTGCCCTCTTATGACTAATCGTAA

Paste this into a BLAST search page for me
GTGAGCGTGACGTCGAACCTGTCGTGAGCAGCTGCGCAAGACCGGCAAGAGACGAGTTCCTCAGCAAGTTTCAGAACGGCAGGCTGAAACTTGAGGTATAATTGAAATATCTTCCACGTTGCCGCGTTGCCGCTCCGAAAGCATTCGATTAGCATTCGATTTGGGTCGCTGTTCATTTACCTTAGTATTTGCTCTTGCCCTTGCTCTTGCCCAAATTGTATGTAGGTATGTAGCTCGTAGTTAACCAATTATCGTACAGCCAACTTTTTGCCTAATTGCCTAAGTATGCAGGTGCCGTATAATGATATACGCCAGTTGCCCTCTTGTTGCCCTCTTATGACTAATCGTAA

Full Affymetrix probeset data:

Annotations for 1626304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720