FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626306_at:

>probe:Drosophila_2:1626306_at:334:31; Interrogation_Position=5722; Antisense; ATAAACCATGGATTTGTCGCATCGT
>probe:Drosophila_2:1626306_at:537:727; Interrogation_Position=5735; Antisense; TTGTCGCATCGTTTGTACTTTGTAT
>probe:Drosophila_2:1626306_at:481:681; Interrogation_Position=5792; Antisense; TATGGTATTGTACGGCTGGCTTGCT
>probe:Drosophila_2:1626306_at:205:571; Interrogation_Position=5809; Antisense; GGCTTGCTATTGTATTCTGTCACCG
>probe:Drosophila_2:1626306_at:151:133; Interrogation_Position=5830; Antisense; ACCGCGCCCAGCACAACGATGAAAG
>probe:Drosophila_2:1626306_at:534:471; Interrogation_Position=5864; Antisense; GTTAAGTGAATCCATGTCGCAGAAG
>probe:Drosophila_2:1626306_at:233:55; Interrogation_Position=5905; Antisense; ATGAAGTTGTTTCCTCCATCATCCA
>probe:Drosophila_2:1626306_at:46:271; Interrogation_Position=5924; Antisense; CATCCACCTTCTCTTTACATATTGA
>probe:Drosophila_2:1626306_at:352:39; Interrogation_Position=6021; Antisense; ATCGGATTGGCCAAACGTTGTTCGT
>probe:Drosophila_2:1626306_at:705:99; Interrogation_Position=6092; Antisense; AGAGAGCATATCCTGTAAGCCACAT
>probe:Drosophila_2:1626306_at:11:661; Interrogation_Position=6107; Antisense; TAAGCCACATGCCAGCTAACAACAA
>probe:Drosophila_2:1626306_at:666:421; Interrogation_Position=6139; Antisense; GAGCAATCAGCAAACCCAGAACTAA
>probe:Drosophila_2:1626306_at:384:203; Interrogation_Position=6181; Antisense; AAGCCTTGACTTGTATTCCATTTAA
>probe:Drosophila_2:1626306_at:108:15; Interrogation_Position=6235; Antisense; GTAGTTTTACGTGTACCAGAAGCGA

Paste this into a BLAST search page for me
ATAAACCATGGATTTGTCGCATCGTTTGTCGCATCGTTTGTACTTTGTATTATGGTATTGTACGGCTGGCTTGCTGGCTTGCTATTGTATTCTGTCACCGACCGCGCCCAGCACAACGATGAAAGGTTAAGTGAATCCATGTCGCAGAAGATGAAGTTGTTTCCTCCATCATCCACATCCACCTTCTCTTTACATATTGAATCGGATTGGCCAAACGTTGTTCGTAGAGAGCATATCCTGTAAGCCACATTAAGCCACATGCCAGCTAACAACAAGAGCAATCAGCAAACCCAGAACTAAAAGCCTTGACTTGTATTCCATTTAAGTAGTTTTACGTGTACCAGAAGCGA

Full Affymetrix probeset data:

Annotations for 1626306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720