Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626307_at:

>probe:Drosophila_2:1626307_at:266:393; Interrogation_Position=1464; Antisense; GAAAGTGTCCAGTTCATCGTCAGAA
>probe:Drosophila_2:1626307_at:712:659; Interrogation_Position=1551; Antisense; TAAAGAGCCCGTTGAGACTCATTTT
>probe:Drosophila_2:1626307_at:374:699; Interrogation_Position=1572; Antisense; TTTTATAGACGTAGGCTCGCTGACC
>probe:Drosophila_2:1626307_at:405:411; Interrogation_Position=1592; Antisense; TGACCTACGGTAGTGTTTTTGGCCT
>probe:Drosophila_2:1626307_at:279:139; Interrogation_Position=1650; Antisense; ACGTACTGTTGTTCAATGCCTGCTC
>probe:Drosophila_2:1626307_at:334:321; Interrogation_Position=1680; Antisense; GCGCTTTTGGCTCCTCGAAGAGGAA
>probe:Drosophila_2:1626307_at:717:147; Interrogation_Position=1704; Antisense; ACAGAATCCGGGTAACATTTGGCAC
>probe:Drosophila_2:1626307_at:364:713; Interrogation_Position=1738; Antisense; TTCTACTTCGAGTGCAATGTGCCGT
>probe:Drosophila_2:1626307_at:618:501; Interrogation_Position=1761; Antisense; GTCGCGTCAGGACTTGTTTACCAAC
>probe:Drosophila_2:1626307_at:370:427; Interrogation_Position=1778; Antisense; TTACCAACTTTCTGAAGACCCGGCA
>probe:Drosophila_2:1626307_at:242:561; Interrogation_Position=1805; Antisense; GGAACAAATTCCGTCACGACTACAT
>probe:Drosophila_2:1626307_at:135:723; Interrogation_Position=1829; Antisense; TTGAAAGCCTGCTAGATCGCGAGGA
>probe:Drosophila_2:1626307_at:575:13; Interrogation_Position=1888; Antisense; ATTATGTGCCGTATCGTGGAGACTA
>probe:Drosophila_2:1626307_at:69:243; Interrogation_Position=1958; Antisense; AATTCTCCGTTTCTTGATTGCTTTA

Paste this into a BLAST search page for me
GAAAGTGTCCAGTTCATCGTCAGAATAAAGAGCCCGTTGAGACTCATTTTTTTTATAGACGTAGGCTCGCTGACCTGACCTACGGTAGTGTTTTTGGCCTACGTACTGTTGTTCAATGCCTGCTCGCGCTTTTGGCTCCTCGAAGAGGAAACAGAATCCGGGTAACATTTGGCACTTCTACTTCGAGTGCAATGTGCCGTGTCGCGTCAGGACTTGTTTACCAACTTACCAACTTTCTGAAGACCCGGCAGGAACAAATTCCGTCACGACTACATTTGAAAGCCTGCTAGATCGCGAGGAATTATGTGCCGTATCGTGGAGACTAAATTCTCCGTTTCTTGATTGCTTTA

Full Affymetrix probeset data:

Annotations for 1626307_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime