Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626308_s_at:

>probe:Drosophila_2:1626308_s_at:70:641; Interrogation_Position=503; Antisense; TCGGCATCGAGTTCGTAATCACCTC
>probe:Drosophila_2:1626308_s_at:452:285; Interrogation_Position=532; Antisense; CTGGTCATCGTCTGCTGCGGAGTGT
>probe:Drosophila_2:1626308_s_at:323:511; Interrogation_Position=555; Antisense; GTGGGATCCGCGCAACTCCAAGTTC
>probe:Drosophila_2:1626308_s_at:82:217; Interrogation_Position=574; Antisense; AAGTTCCATGACTCCGTGGGCATTC
>probe:Drosophila_2:1626308_s_at:585:517; Interrogation_Position=589; Antisense; GTGGGCATTCGATTTGGCCTGGCCA
>probe:Drosophila_2:1626308_s_at:405:295; Interrogation_Position=684; Antisense; CGCCCTGTGGAACAAGCACTTCGAG
>probe:Drosophila_2:1626308_s_at:661:419; Interrogation_Position=708; Antisense; GAGCAACTGGATCTACTGGCTGGCC
>probe:Drosophila_2:1626308_s_at:454:541; Interrogation_Position=792; Antisense; GGTTGAGGCGGAGATCACCTCCAAT
>probe:Drosophila_2:1626308_s_at:699:407; Interrogation_Position=838; Antisense; GACGTCCAGCTGTCGTAAGGCCAAA
>probe:Drosophila_2:1626308_s_at:528:183; Interrogation_Position=921; Antisense; AAAATAATGCATTCGTTGTACGCTA
>probe:Drosophila_2:1626308_s_at:689:337; Interrogation_Position=942; Antisense; GCTAATGTTAGCAGTGTCTTCACAA
>probe:Drosophila_2:1626308_s_at:664:643; Interrogation_Position=961; Antisense; TCACAAAGTGGCTCGAACGTTTCAA
>probe:Drosophila_2:1626308_s_at:725:183; Interrogation_Position=984; Antisense; AAAAGGCGAACCAAGTGCACACACT
>probe:Drosophila_2:1626308_s_at:704:509; Interrogation_Position=998; Antisense; GTGCACACACTTACATAAGCCCTTG

Paste this into a BLAST search page for me
TCGGCATCGAGTTCGTAATCACCTCCTGGTCATCGTCTGCTGCGGAGTGTGTGGGATCCGCGCAACTCCAAGTTCAAGTTCCATGACTCCGTGGGCATTCGTGGGCATTCGATTTGGCCTGGCCACGCCCTGTGGAACAAGCACTTCGAGGAGCAACTGGATCTACTGGCTGGCCGGTTGAGGCGGAGATCACCTCCAATGACGTCCAGCTGTCGTAAGGCCAAAAAAATAATGCATTCGTTGTACGCTAGCTAATGTTAGCAGTGTCTTCACAATCACAAAGTGGCTCGAACGTTTCAAAAAAGGCGAACCAAGTGCACACACTGTGCACACACTTACATAAGCCCTTG

Full Affymetrix probeset data:

Annotations for 1626308_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime