Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626309_at:

>probe:Drosophila_2:1626309_at:122:475; Interrogation_Position=4198; Antisense; GTTAGAGATCCAAAGTCGTGCAGCA
>probe:Drosophila_2:1626309_at:620:351; Interrogation_Position=4217; Antisense; GCAGCAGGTTTTATGTTTGTGCCAA
>probe:Drosophila_2:1626309_at:641:227; Interrogation_Position=4240; Antisense; AATGGACGGGCTATACCTCGACAGT
>probe:Drosophila_2:1626309_at:186:303; Interrogation_Position=4267; Antisense; CCCCAGGGCCTACATTTTGACATAA
>probe:Drosophila_2:1626309_at:321:239; Interrogation_Position=4314; Antisense; AATCTTGGTACAGTGCTCCTTGGAG
>probe:Drosophila_2:1626309_at:111:239; Interrogation_Position=4340; Antisense; AATCTCAGGCTGATGCACACGGAGC
>probe:Drosophila_2:1626309_at:256:435; Interrogation_Position=4375; Antisense; GAGGGAGTACCCGATTGCACCAAAG
>probe:Drosophila_2:1626309_at:477:699; Interrogation_Position=4474; Antisense; TTGCATTACTGCAGTCCGGGAAATT
>probe:Drosophila_2:1626309_at:25:591; Interrogation_Position=4498; Antisense; TGGTTCGACCTTCGCAGCCAGAAAT
>probe:Drosophila_2:1626309_at:92:167; Interrogation_Position=4519; Antisense; AAATGCATTGACCAGCGGCTGGCTA
>probe:Drosophila_2:1626309_at:370:263; Interrogation_Position=4531; Antisense; CAGCGGCTGGCTAAGGTGACCTAAG
>probe:Drosophila_2:1626309_at:700:511; Interrogation_Position=4546; Antisense; GTGACCTAAGCACTCGTTACATATT
>probe:Drosophila_2:1626309_at:646:349; Interrogation_Position=4705; Antisense; GCAGACTCTAATACGACCTAGCCAG
>probe:Drosophila_2:1626309_at:80:135; Interrogation_Position=4717; Antisense; ACGACCTAGCCAGTTGAAGTGTTCA

Paste this into a BLAST search page for me
GTTAGAGATCCAAAGTCGTGCAGCAGCAGCAGGTTTTATGTTTGTGCCAAAATGGACGGGCTATACCTCGACAGTCCCCAGGGCCTACATTTTGACATAAAATCTTGGTACAGTGCTCCTTGGAGAATCTCAGGCTGATGCACACGGAGCGAGGGAGTACCCGATTGCACCAAAGTTGCATTACTGCAGTCCGGGAAATTTGGTTCGACCTTCGCAGCCAGAAATAAATGCATTGACCAGCGGCTGGCTACAGCGGCTGGCTAAGGTGACCTAAGGTGACCTAAGCACTCGTTACATATTGCAGACTCTAATACGACCTAGCCAGACGACCTAGCCAGTTGAAGTGTTCA

Full Affymetrix probeset data:

Annotations for 1626309_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime