Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626311_at:

>probe:Drosophila_2:1626311_at:504:729; Interrogation_Position=1535; Antisense; TTGGCACACGGTAAGGCCACGTCTT
>probe:Drosophila_2:1626311_at:635:141; Interrogation_Position=1540; Antisense; ACACGGTAAGGCCACGTCTTCCTGC
>probe:Drosophila_2:1626311_at:101:539; Interrogation_Position=1544; Antisense; GGTAAGGCCACGTCTTCCTGCACTT
>probe:Drosophila_2:1626311_at:303:139; Interrogation_Position=1553; Antisense; ACGTCTTCCTGCACTTCAATTTTAT
>probe:Drosophila_2:1626311_at:489:497; Interrogation_Position=1555; Antisense; GTCTTCCTGCACTTCAATTTTATTG
>probe:Drosophila_2:1626311_at:423:275; Interrogation_Position=1557; Antisense; CTTCCTGCACTTCAATTTTATTGAA
>probe:Drosophila_2:1626311_at:131:373; Interrogation_Position=1579; Antisense; GAAGGGTTTATATTGTATCCGTGTT
>probe:Drosophila_2:1626311_at:225:531; Interrogation_Position=1582; Antisense; GGGTTTATATTGTATCCGTGTTCTC
>probe:Drosophila_2:1626311_at:157:689; Interrogation_Position=1587; Antisense; TATATTGTATCCGTGTTCTCTTCTC
>probe:Drosophila_2:1626311_at:328:21; Interrogation_Position=1588; Antisense; ATATTGTATCCGTGTTCTCTTCTCT
>probe:Drosophila_2:1626311_at:407:5; Interrogation_Position=1590; Antisense; ATTGTATCCGTGTTCTCTTCTCTCC
>probe:Drosophila_2:1626311_at:89:715; Interrogation_Position=1607; Antisense; TTCTCTCCCCACTAACAGTTTTTGG
>probe:Drosophila_2:1626311_at:176:637; Interrogation_Position=1610; Antisense; TCTCCCCACTAACAGTTTTTGGCTG
>probe:Drosophila_2:1626311_at:512:631; Interrogation_Position=1612; Antisense; TCCCCACTAACAGTTTTTGGCTGTT

Paste this into a BLAST search page for me
TTGGCACACGGTAAGGCCACGTCTTACACGGTAAGGCCACGTCTTCCTGCGGTAAGGCCACGTCTTCCTGCACTTACGTCTTCCTGCACTTCAATTTTATGTCTTCCTGCACTTCAATTTTATTGCTTCCTGCACTTCAATTTTATTGAAGAAGGGTTTATATTGTATCCGTGTTGGGTTTATATTGTATCCGTGTTCTCTATATTGTATCCGTGTTCTCTTCTCATATTGTATCCGTGTTCTCTTCTCTATTGTATCCGTGTTCTCTTCTCTCCTTCTCTCCCCACTAACAGTTTTTGGTCTCCCCACTAACAGTTTTTGGCTGTCCCCACTAACAGTTTTTGGCTGTT

Full Affymetrix probeset data:

Annotations for 1626311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime