FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626313_at:

>probe:Drosophila_2:1626313_at:611:191; Interrogation_Position=1023; Antisense; CACCGGACTTAACTGGAGGGCCTAT
>probe:Drosophila_2:1626313_at:590:549; Interrogation_Position=1037; Antisense; GGAGGGCCTATTACCTGAAGTACAT
>probe:Drosophila_2:1626313_at:465:489; Interrogation_Position=1056; Antisense; GTACATCACTGGTAGTTGGACACGA
>probe:Drosophila_2:1626313_at:92:139; Interrogation_Position=1235; Antisense; ACGATAATTCAAGTGCAAGGGCAAT
>probe:Drosophila_2:1626313_at:397:481; Interrogation_Position=1260; Antisense; GTATTCGAAGTGATTGAGGCGTTTG
>probe:Drosophila_2:1626313_at:514:439; Interrogation_Position=1275; Antisense; GAGGCGTTTGATTTGCATTATGCTT
>probe:Drosophila_2:1626313_at:103:667; Interrogation_Position=1322; Antisense; TACACACTTAATTCGACTGATCATT
>probe:Drosophila_2:1626313_at:422:493; Interrogation_Position=858; Antisense; GTCAATACTTTCTACCCTGAACAAC
>probe:Drosophila_2:1626313_at:523:187; Interrogation_Position=880; Antisense; AACACGATTCCAACAACTCGCTAAC
>probe:Drosophila_2:1626313_at:514:131; Interrogation_Position=895; Antisense; ACTCGCTAACCCATAGTTTTCTCAA
>probe:Drosophila_2:1626313_at:634:675; Interrogation_Position=908; Antisense; TAGTTTTCTCAAAAATCCCTCGTTG
>probe:Drosophila_2:1626313_at:144:157; Interrogation_Position=920; Antisense; AAATCCCTCGTTGAGCTAACCGACA
>probe:Drosophila_2:1626313_at:159:413; Interrogation_Position=932; Antisense; GAGCTAACCGACACAAGTTTCAAAT
>probe:Drosophila_2:1626313_at:567:91; Interrogation_Position=998; Antisense; AGTTTATCTAGCACACTGACTGCCT

Paste this into a BLAST search page for me
CACCGGACTTAACTGGAGGGCCTATGGAGGGCCTATTACCTGAAGTACATGTACATCACTGGTAGTTGGACACGAACGATAATTCAAGTGCAAGGGCAATGTATTCGAAGTGATTGAGGCGTTTGGAGGCGTTTGATTTGCATTATGCTTTACACACTTAATTCGACTGATCATTGTCAATACTTTCTACCCTGAACAACAACACGATTCCAACAACTCGCTAACACTCGCTAACCCATAGTTTTCTCAATAGTTTTCTCAAAAATCCCTCGTTGAAATCCCTCGTTGAGCTAACCGACAGAGCTAACCGACACAAGTTTCAAATAGTTTATCTAGCACACTGACTGCCT

Full Affymetrix probeset data:

Annotations for 1626313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720