FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626314_at:

>probe:Drosophila_2:1626314_at:284:323; Interrogation_Position=1025; Antisense; GCGCGGATGCCGATTAAGTCTAGTA
>probe:Drosophila_2:1626314_at:606:105; Interrogation_Position=606; Antisense; AGAAAATGTGCACGAGCTGACGCCG
>probe:Drosophila_2:1626314_at:529:427; Interrogation_Position=649; Antisense; GAGATAGTGCACATCGACATTGCCA
>probe:Drosophila_2:1626314_at:175:403; Interrogation_Position=664; Antisense; GACATTGCCAACGATCCGGTGCTGC
>probe:Drosophila_2:1626314_at:713:403; Interrogation_Position=694; Antisense; GACTACAAGCCCGATGAGGATCCAA
>probe:Drosophila_2:1626314_at:566:309; Interrogation_Position=750; Antisense; TCCCCTGGTGGGATCCGACTGGAAA
>probe:Drosophila_2:1626314_at:550:655; Interrogation_Position=783; Antisense; TAATCCTGTCATGACCTGCTACAAG
>probe:Drosophila_2:1626314_at:365:253; Interrogation_Position=804; Antisense; CAAGCTGGTCACGTGCGAGTTCAAA
>probe:Drosophila_2:1626314_at:23:475; Interrogation_Position=822; Antisense; GTTCAAATGGTTCGGCCTGCAAACA
>probe:Drosophila_2:1626314_at:530:663; Interrogation_Position=863; Antisense; TACAGAAATCGGAGCGTCGCCTCTT
>probe:Drosophila_2:1626314_at:402:615; Interrogation_Position=884; Antisense; TCTTTACAAACTTCCATCGCCAAGT
>probe:Drosophila_2:1626314_at:197:217; Interrogation_Position=905; Antisense; AAGTTTTCTGTTCAACCGATCGCTG
>probe:Drosophila_2:1626314_at:386:293; Interrogation_Position=921; Antisense; CGATCGCTGGTACGGTCTAACAATG
>probe:Drosophila_2:1626314_at:250:229; Interrogation_Position=942; Antisense; AATGGAGGACATTCGCGCCATCGAG

Paste this into a BLAST search page for me
GCGCGGATGCCGATTAAGTCTAGTAAGAAAATGTGCACGAGCTGACGCCGGAGATAGTGCACATCGACATTGCCAGACATTGCCAACGATCCGGTGCTGCGACTACAAGCCCGATGAGGATCCAATCCCCTGGTGGGATCCGACTGGAAATAATCCTGTCATGACCTGCTACAAGCAAGCTGGTCACGTGCGAGTTCAAAGTTCAAATGGTTCGGCCTGCAAACATACAGAAATCGGAGCGTCGCCTCTTTCTTTACAAACTTCCATCGCCAAGTAAGTTTTCTGTTCAACCGATCGCTGCGATCGCTGGTACGGTCTAACAATGAATGGAGGACATTCGCGCCATCGAG

Full Affymetrix probeset data:

Annotations for 1626314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720